Entry information : AlyPrx05
Entry ID 7482
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx05
Name AlyPrx05
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx05
start..stop
S start..stop
AhalPrx57 654 0 1..321 1..321
BstrPrx37 641 0 1..321 1..321
AtPrx05 637 0 1..321 1..321
CrubPrx88 624 0 1..321 1..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6144420..6144632 213 N° 2 6144705..6144896 192 N° 3 6144986..6145154 169 N° 4 6145318..6145709 392
join(6144420..6144632,6144705..6144896,6144986..6145154,6145318..6145709)


exon

Literature and cross-references AlyPrx05
DNA ref. Phytozome 12:   scaffold_1 (6144420..6145709)
Protein sequence: AlyPrx05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (297)
PWM (Da):   %s   35004.74 (32188.3)  
PI (pH):   %s   8.63 (8.56) Peptide Signal:   %s   cut: 25 range:25-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MERFSLRFVLMMVSIILTFSICQAQLSPTFYDQSCPSALSKIRSSIRTAITRERRMAASLIRMHFHDCFVHGCDASILLEGTSKIESERDALPNFKSVRGFEVIDKAKSEVEKVCPGIVSCADIIAVAARDASEYVGGPKWAVKVGRRDSTTAFKALANSGELPGFKDNLDQLSGLFSKKGLNTRDLVALSGAHTIGQSQCFLFRDRLYENSSDIDAGFASTRKRRCPTVGSDGNLAALDLVTPNSFDNNYYKNLMQKKGLLVTDQVLFGSGASTDGIVSEYSRNRSKFAADFATAMIKMGDIEPLTGSTGEIRKICSFVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGATTTTCACTAAGGTTTGTGCTAATGATGGTAAGCATCATCCTTACGTTCTCGATTTGTCAAGCCCAACTTTCTCCAACATTTTACGATCAATCGTGTCCGAGCGCTCTTTCC
AAGATCAGATCCTCCATTAGAACCGCAATCACTCGTGAGAGACGAATGGCCGCGTCCCTAATCCGCATGCACTTCCACGACTGTTTTGTTCAT
GTAAGTTTTTACTCTTTCAAATTTTTA
AAAAACCTTACAAAATCATTTTATAATAGTTTTGTGTATGTTTAGGGTTGTGACGCTTCGATATTGCTCGAGGGAACATCAAAGATAGAGAGTGAGCGAGATGCATTGCCAAACTTCAAA
TCAGTAAGAGGTTTTGAAGTCATAGATAAAGCCAAATCTGAAGTCGAGAAAGTTTGTCCGGGCATTGTTTCTTGCGCTGATATCATAGCGGTTGCGGCAAGAGATGCTTCTGAATAC
GTA
TGTTTGGGATTATAGATGAATACACCTAATATCCTTTGTACTATAAACCATGCATGTATAACAATTGGTCCAACTCCAATATTTAGGTGGGAGGTCCAAAATGGGCAGTGAAAGTCGGAA
GGAGAGATTCGACGACCGCATTTAAGGCTTTAGCAAATAGTGGTGAACTTCCTGGCTTTAAAGATAACCTTGACCAACTCTCTGGTCTCTTCAGCAAGAAAGGCCTTAACACTAGAGACC
TTGTCGCTCTATCAG
GTCGGTCCAAAAATCATTATTTTTACATATAAAGTTTAAATTTGAGATCTAAATTTTCATAAAATGTGTGAATTGCTAGCTAATTGCTTTTCACTAGTTTTATAT
AGTGTCTACGCATATTTCTAAACGATCTTCTTATAATATTTGCACGAAAACTATTCAGGAGCTCACACCATAGGACAATCTCAATGCTTCTTATTCCGGGACAGGCTTTACGAGAACTCA
AGCGACATCGACGCAGGATTTGCCAGCACACGCAAACGTCGATGCCCAACCGTGGGAAGTGATGGGAATCTGGCAGCATTGGATCTCGTGACACCTAATTCTTTCGACAACAATTACTAC
AAGAACCTAATGCAAAAGAAAGGACTTTTAGTAACCGATCAAGTTTTGTTCGGATCCGGTGCATCAACTGACGGCATTGTGTCGGAATATAGCAGGAACCGGTCAAAATTCGCTGCAGAT
TTCGCAACAGCCATGATCAAGATGGGTGATATTGAACCTCTTACCGGCTCTACCGGAGAAATCAGAAAGATATGCAGCTTTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGATTTTCACTAAGGTTTGTGCTAATGATGGTAAGCATCATCCTTACGTTCTCGATTTGTCAAGCCCAACTTTCTCCAACATTTTACGATCAATCGTGTCCGAGCGCTCTTTCC
AAGATCAGATCCTCCATTAGAACCGCAATCACTCGTGAGAGACGAATGGCCGCGTCCCTAATCCGCATGCACTTCCACGACTGTTTTGTTCAT
GGTTGTGACGCTTCGATATTGCTCGAG
GGAACATCAAAGATAGAGAGTGAGCGAGATGCATTGCCAAACTTCAAATCAGTAAGAGGTTTTGAAGTCATAGATAAAGCCAAATCTGAAGTCGAGAAAGTTTGTCCGGGCATTGTTTCT
TGCGCTGATATCATAGCGGTTGCGGCAAGAGATGCTTCTGAATAC
GTGGGAGGTCCAAAATGGGCAGTGAAAGTCGGAAGGAGAGATTCGACGACCGCATTTAAGGCTTTAGCAAATAGT
GGTGAACTTCCTGGCTTTAAAGATAACCTTGACCAACTCTCTGGTCTCTTCAGCAAGAAAGGCCTTAACACTAGAGACCTTGTCGCTCTATCAG
GAGCTCACACCATAGGACAATCTCAA
TGCTTCTTATTCCGGGACAGGCTTTACGAGAACTCAAGCGACATCGACGCAGGATTTGCCAGCACACGCAAACGTCGATGCCCAACCGTGGGAAGTGATGGGAATCTGGCAGCATTGGAT
CTCGTGACACCTAATTCTTTCGACAACAATTACTACAAGAACCTAATGCAAAAGAAAGGACTTTTAGTAACCGATCAAGTTTTGTTCGGATCCGGTGCATCAACTGACGGCATTGTGTCG
GAATATAGCAGGAACCGGTCAAAATTCGCTGCAGATTTCGCAACAGCCATGATCAAGATGGGTGATATTGAACCTCTTACCGGCTCTACCGGAGAAATCAGAAAGATATGCAGCTTTGTT
AATTAA

Retrieve as FASTA