Entry information : AlyPrx16
Entry ID 7486
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx16
Name AlyPrx16
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx16
start..stop
S start..stop
AtPrx16 635 0 1..323 1..323
CagraPrx13 598 0 1..323 1..323
CrubPrx115 596 0 1..323 1..323
BrPrx45-1Ab_other 568 0 1..323 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23546745..23546954 210 N° 2 23547529..23547717 189 N° 3 23548323..23548488 166 N° 4 23548573..23548979 407
join(23546745..23546954,23547529..23547717,23548323..23548488,23548573..23548979 )


exon

Literature and cross-references AlyPrx16
DNA ref. Phytozome 11:   scaffold_3 (23546745..23548979)
Protein sequence: AlyPrx16
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35776.31 (33240.0) Transmb domain:   %s   i5-27o
PI (pH):   %s   10.06 (10.01) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKYQGSFSIVALFLILFSSSVFAQLQTNFYRKSCPNVETIVRNPVRQKFQQTFVTAPAILRLFFHDCFVRGCDASILLASPSEKDHPDDKSLAGDGFDTVAKAKQAVDRDPNCRNKVSCADILALATRDVVVLTGGPNYPVELGRRDGRLSTIASVQHSLPQPSFKLDQLNTMFARHGLSQTDMIALSGAHTIGFAHCGRFSKRIYNFSPKRPIDPTLNTQYALQLRQMCPIRVDPRIAINMDPTSPNTFDNAYFKNLQKGMGLFTSDQVLFSDQRSRSTVNSFASNEATFRQAFILAITKLGRVGVKTGNAGEIRRDCSRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTACCAAGGCAGCTTCTCCATTGTTGCTCTTTTTCTCATTCTCTTTTCTTCATCTGTCTTTGCTCAGCTACAGACAAATTTTTACCGGAAGTCATGTCCTAACGTCGAAACTATT
GTCCGCAACCCCGTCCGCCAAAAGTTCCAACAGACTTTTGTTACGGCTCCAGCCATCCTCCGCCTTTTCTTCCATGATTGCTTCGTCCGT
GTAAGATTTTTATCTAATCGATATATTGAA
TTTTTTCCCCATAAAATTTGTGTTTAAGTTTACATTTTGTAAACGATATTGGATAGAAAAAGCAGACTATGTGTTTTTTCATGAAATACAATTATTAAACAAGTAAATGAAAAATATAAA
TATGAATGTTTGTTTAAAACAATGAAAAAGTGTTATTGGTACTTTCATTTGCAAAAAAGTTTTTTAGATAGATTTTTATTATTTTGGTTTATTGATTCTTCTTATTCTACATAATTTCAA
TGGTTTGATGATTTTTAAATTCCACTCAAAATCTCTTTGTTTTTCAAAACGTTTAGTTATATTGATTTTGTAATTCTACGAATTTTGAATGTTGTTGAAACAAAGATATTCAATTTATAA
AAACTAAACGTTCAAAATACTATGAAGTTGTCATCATGTTTTAAAAATTTATAAAACATAATGAAATCTCTCAACTAAACAAAAAGGATCTCTGCCAAAATGCAAATTAAAGTACCAATA
ATTAATTCTTAGGAAGACCCATTCTCTTGTATATATTGTTTTGACTATTTAACGTTATATACAGGGTTGTGATGCTTCGATATTGCTGGCGTCTCCATCGGAGAAAGATCACCCTGATGA
CAAGTCACTAGCCGGAGACGGGTTTGACACGGTGGCAAAGGCAAAGCAGGCCGTTGATAGGGATCCCAATTGCCGTAACAAAGTCTCATGCGCTGACATTTTGGCTCTAGCCACTCGTGA
CGTCGTCGTTTTG
GTACATTTCAACTCTTATATTGATCGTCTTTTTCTAGTTTCCTCGACAACTTTTATCCATCTATTCAGAATTCTATTACTCATCTAGGCTAAAGGGAAATGTCAAAA
ACACAACAAAAAAAAACCTAGGCTAAAAGGAAAAACAATTCTTGTATTCCTTCTTTTGTGACACTAAGTAACATTAATACATTACTGTTTCGTTTATATGTAAAAAAAAACAAAATCATG
ATTATAAAAAAATCACTAACGATTTGGTTATTATTAATATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTTGGTTATTATTCTTTTTGTGTGATCATCCATAAAGTT
CGGATTCCAATAACGAGAAGGCAACTTATGTGCAGATTTCCTAGCTAAGAGAGTGCTCTCATGTAATGAGTTATGGTCTTTGTATAATGCTTATCCATCTTTTCTAAACATTCTTGTAAA
CCATGACATTGACTATGAAAGCTAATAAAGTTTTTAGAAGGAAAAATAAAAAAAATCTTTTTGTGTGATTATTATTTTTTTTTTTGTGTGTTATTGTTACTAAAAGACAGTGAAACTAAA
GATAATAATATATTGTAGACTGGCGGACCGAACTATCCGGTAGAGCTAGGGAGGAGAGACGGCAGACTATCGACGATAGCTAGCGTTCAACACAGTCTACCCCAGCCTAGTTTCAAATTG
GACCAACTTAACACTATGTTCGCTCGTCACGGTCTATCCCAAACCGATATGATCGCACTCTCAG
GTATTTAAACCGATGCAAACTGGATTAGACCGATTTTCATATATCTTAGAACCAAG
TCTAACAGTTGATTTTTATGATATATAGGAGCACATACTATCGGATTCGCACATTGTGGAAGGTTTTCAAAGAGAATTTACAATTTTAGTCCTAAACGCCCGATTGATCCGACTTTAAAT
ACTCAATACGCGTTACAGTTGAGACAAATGTGTCCCATTCGGGTTGACCCGAGGATCGCGATTAATATGGATCCAACTTCTCCAAATACCTTTGACAATGCTTATTTCAAAAACCTCCAA
AAAGGGATGGGTTTGTTCACGTCAGATCAAGTTTTGTTCTCTGATCAACGGTCTAGATCAACTGTCAATTCATTTGCTTCTAATGAAGCAACTTTTAGACAAGCTTTTATTTTGGCTATA
ACGAAGTTGGGTCGGGTTGGAGTTAAAACCGGTAACGCCGGTGAGATAAGACGGGATTGTTCACGTGTTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTACCAAGGCAGCTTCTCCATTGTTGCTCTTTTTCTCATTCTCTTTTCTTCATCTGTCTTTGCTCAGCTACAGACAAATTTTTACCGGAAGTCATGTCCTAACGTCGAAACTATT
GTCCGCAACCCCGTCCGCCAAAAGTTCCAACAGACTTTTGTTACGGCTCCAGCCATCCTCCGCCTTTTCTTCCATGATTGCTTCGTCCGT
GGTTGTGATGCTTCGATATTGCTGGCGTCT
CCATCGGAGAAAGATCACCCTGATGACAAGTCACTAGCCGGAGACGGGTTTGACACGGTGGCAAAGGCAAAGCAGGCCGTTGATAGGGATCCCAATTGCCGTAACAAAGTCTCATGCGCT
GACATTTTGGCTCTAGCCACTCGTGACGTCGTCGTTTTG
ACTGGCGGACCGAACTATCCGGTAGAGCTAGGGAGGAGAGACGGCAGACTATCGACGATAGCTAGCGTTCAACACAGTCTA
CCCCAGCCTAGTTTCAAATTGGACCAACTTAACACTATGTTCGCTCGTCACGGTCTATCCCAAACCGATATGATCGCACTCTCAG
GAGCACATACTATCGGATTCGCACATTGTGGAAGG
TTTTCAAAGAGAATTTACAATTTTAGTCCTAAACGCCCGATTGATCCGACTTTAAATACTCAATACGCGTTACAGTTGAGACAAATGTGTCCCATTCGGGTTGACCCGAGGATCGCGATT
AATATGGATCCAACTTCTCCAAATACCTTTGACAATGCTTATTTCAAAAACCTCCAAAAAGGGATGGGTTTGTTCACGTCAGATCAAGTTTTGTTCTCTGATCAACGGTCTAGATCAACT
GTCAATTCATTTGCTTCTAATGAAGCAACTTTTAGACAAGCTTTTATTTTGGCTATAACGAAGTTGGGTCGGGTTGGAGTTAAAACCGGTAACGCCGGTGAGATAAGACGGGATTGTTCA
CGTGTTAATTAG

Retrieve as FASTA