Entry information : AlyPrx37
Entry ID 7488
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx37
Name AlyPrx37
Class Class III peroxidase    [Orthogroup: Prx035]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx37
start..stop
S start..stop
AtPrx37 657 0 14..345 15..346
AhalPrx27 654 0 15..345 16..346
BstrPrx36 648 0 1..345 1..344
AlyPrx38-1 648 0 1..345 1..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18894845..18895048 204 N° 2 18894340..18894531 192 N° 3 18894067..18894235 169 N° 4 18893485..18893957 473
complement(join(18893485..18893957,18894067..18894235,18894340..18894531,1889484 5..18895048))


exon

Literature and cross-references AlyPrx37
DNA ref. Phytozome 12:   scaffold_6 (18895048..18893485)
Protein sequence: AlyPrx37
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   345 (324)
PWM (Da):   %s   38020.41 (35732.1)  
PI (pH):   %s   8.57 (8.39) Peptide Signal:   %s   cut: 22 range:22-345
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHSSLIKLGFLLLLQVSLSHAQLSPSFYDKTCPQVFDIVTNTIVNALRSDPRIAASIIRLHFHDCFVNGCDASILLDNTTSFRTEKDAFGNANSARGFDVIDKMKAAVEKACPRTVSCADLLAIAAQESVVLAGGPSWRVPNGRRDSLRGFMDLANNNLPAPSFTLKQLKDRFKNVGLDRASDLVALSGGHTFGKNQCRFIMDRLYNFSDTGLPDPTLDKSYLTTLRKQCPRNGNQSVLVDFDLRTPTLFDNKYYVNLKENKGLIQSDQELFSSPDASDTLPLVREFADGQGKFFDAFAKAMIRMSSLSPLTGKQGEIRLNCRVVNSKPRIMDVVEDAIKFASSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCTCTTTGATAAAATTGGGATTTCTTCTTCTTCTTCAGGTCTCATTGTCTCATGCTCAACTAAGCCCTTCCTTTTATGATAAAACATGTCCGCAAGTCTTTGACATTGTAACC
AATACCATTGTCAATGCTCTGAGATCAGACCCTCGCATCGCTGCAAGCATCATTCGTCTTCATTTCCACGACTGCTTTGTTAAT
GTAAGATACCATTAGATTCAATATATTCATGTATAT
GTTAACTCTTTTGGTTCCCTATAGTTTATCCTAAAGAGTTATACGGATATAATAAACTACTACATGGCGAATTAATGCTGCCTTCGGATTCACGTAAATAAAGTTATGCTATCGATAGTT
GGATACTAGATTTACTATTTTTCTTGCAGTAAAAGGAGAAAAAAAATTAGCAGTAGATATAACTTGTTTATATAAAAATTGAAAGAGACTAATTAAGATCAACTGTTTACGGATGTTAAG
ATTTTTTTTATTTAACAATATTTTGTTTTTTAAAAAGGGATGTGATGCATCGATATTGTTAGACAACACCACATCGTTTAGGACGGAGAAAGACGCCTTTGGGAACGCTAATTCCGCTCG
AGGTTTCGATGTGATCGACAAAATGAAGGCTGCCGTAGAGAAAGCATGTCCTAGAACTGTTTCATGTGCTGATTTGCTCGCCATCGCAGCTCAAGAATCTGTTGTTTTG
GTATGCATCTT
TTACTATGCTATGCAAATGGTTTCTAGAGTACCATTTTGTTAACTTTTTAAGGAGGATAAAGTATTTAGACCAAATATAATTGTTTACTTTAGGCAGGAGGTCCTTCATGGAGGGTTCCA
AATGGAAGAAGAGACAGCTTAAGAGGGTTTATGGATCTTGCTAATAATAACCTTCCAGCTCCATCCTTTACCCTTAAACAACTTAAGGATAGATTCAAAAATGTCGGACTCGACCGTGCT
TCTGATCTCGTTGCTCTTTCCG
GTACGTTATCATTGGAAACATTTTCACGTATAGCTGTAATAACTAATATCTCTATATGATAGATTATTGGTCTAGTTTATTTATACTTTTGATATTTT
TCTTTGGTTAGGTGGTCACACTTTTGGCAAAAACCAATGTCGGTTCATAATGGATCGGCTTTACAACTTCAGTGACACCGGTTTACCCGACCCAACCCTTGATAAATCTTATCTCACCAC
ACTCAGAAAACAATGTCCGCGTAACGGAAACCAGAGTGTCTTGGTAGATTTTGATTTACGTACACCAACACTCTTTGACAACAAATACTATGTGAATCTCAAAGAGAACAAAGGACTTAT
CCAGAGCGACCAAGAGTTATTCTCTAGCCCTGATGCTTCGGACACTCTCCCTTTAGTCCGAGAATTCGCTGATGGTCAAGGAAAATTTTTCGATGCGTTCGCGAAGGCAATGATAAGGAT
GAGTAGTCTTTCACCTTTAACAGGGAAGCAAGGAGAAATAAGATTGAATTGTAGAGTGGTGAATTCGAAACCGAGAATCATGGATGTGGTAGAAGATGCTATTAAATTTGCTAGCTCAAT
GTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCTCTTTGATAAAATTGGGATTTCTTCTTCTTCTTCAGGTCTCATTGTCTCATGCTCAACTAAGCCCTTCCTTTTATGATAAAACATGTCCGCAAGTCTTTGACATTGTAACC
AATACCATTGTCAATGCTCTGAGATCAGACCCTCGCATCGCTGCAAGCATCATTCGTCTTCATTTCCACGACTGCTTTGTTAAT
GGATGTGATGCATCGATATTGTTAGACAACACCACA
TCGTTTAGGACGGAGAAAGACGCCTTTGGGAACGCTAATTCCGCTCGAGGTTTCGATGTGATCGACAAAATGAAGGCTGCCGTAGAGAAAGCATGTCCTAGAACTGTTTCATGTGCTGAT
TTGCTCGCCATCGCAGCTCAAGAATCTGTTGTTTTG
GCAGGAGGTCCTTCATGGAGGGTTCCAAATGGAAGAAGAGACAGCTTAAGAGGGTTTATGGATCTTGCTAATAATAACCTTCCA
GCTCCATCCTTTACCCTTAAACAACTTAAGGATAGATTCAAAAATGTCGGACTCGACCGTGCTTCTGATCTCGTTGCTCTTTCCG
GTGGTCACACTTTTGGCAAAAACCAATGTCGGTTC
ATAATGGATCGGCTTTACAACTTCAGTGACACCGGTTTACCCGACCCAACCCTTGATAAATCTTATCTCACCACACTCAGAAAACAATGTCCGCGTAACGGAAACCAGAGTGTCTTGGTA
GATTTTGATTTACGTACACCAACACTCTTTGACAACAAATACTATGTGAATCTCAAAGAGAACAAAGGACTTATCCAGAGCGACCAAGAGTTATTCTCTAGCCCTGATGCTTCGGACACT
CTCCCTTTAGTCCGAGAATTCGCTGATGGTCAAGGAAAATTTTTCGATGCGTTCGCGAAGGCAATGATAAGGATGAGTAGTCTTTCACCTTTAACAGGGAAGCAAGGAGAAATAAGATTG
AATTGTAGAGTGGTGAATTCGAAACCGAGAATCATGGATGTGGTAGAAGATGCTATTAAATTTGCTAGCTCAATGTGA

Retrieve as FASTA