Entry information : AlyPrx48
Entry ID 7492
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx48
Name AlyPrx48
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx48
start..stop
S start..stop
AhalPrx36 780 0 1..405 1..405
AtPrx48 760 0 1..405 1..404
CrubPrx86 652 0 1..405 1..414
BstrPrx32 635 0 1..393 3..390
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3080857..3081198 342 N° 2 3081610..3081798 189 N° 3 3081878..3082043 166 N° 4 3082178..3082698 521
join(3080857..3081198,3081610..3081798,3081878..3082043,3082178..3082698)


exon

Literature and cross-references AlyPrx48
DNA ref. Phytozome 12:   scaffold_7 (3080857..3082698)
Protein sequence: AlyPrx48
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   405
PWM (Da):   %s   44490.09 Transmb domain:   %s   i7-25o
PI (pH):   %s   4.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRFLGDYKIALLTCSVIALSIYFAIKGVEFRFANDSPGNRNGGKVSEKSLFEDEFMYMSIAEDIDRSHLHYDYYRESCPTAEKIIAKASRDIYNVTPSVAPSLIRLLFHDCFIEGCDASVLLDADEAHTSEKDASPNLSLKGFDVIDAIKSELENVCPGVVSCADLLVLAAREAVLVAGGPFYPLETGRKDSAAAFREIAEQQLPAPDATLSEILERFSVRGFNERETVSLFGAHSIGITHCTFFKNRLYNFSATGKPDPELNPGFLQELKTKCPFSVSASSPSASPGTGLLPSLPASDSENSYGMSSGKRNDEVIDLSYNNEGGDENFGTRYFRRLMQKKGLLFSDQQLMGSEVTEMWVRAYASDPLLFRREFAMSMMKLSSNHVLTGPLGQVRTSCSKALPRN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTCTCGGAGACTACAAGATCGCTTTACTTACTTGCTCCGTTATCGCTCTCAGCATCTACTTTGCGATTAAAGGCGTCGAATTTCGTTTCGCGAACGATTCACCGGGAAATCGT
AACGGAGGTAAGGTTTCCGAGAAATCTCTCTTCGAAGATGAATTCATGTACATGTCAATCGCTGAAGATATCGATCGATCTCACCTCCACTACGATTACTACCGTGAATCTTGCCCTACC
GCCGAGAAAATCATCGCGAAAGCTAGCAGAGATATCTACAATGTCACACCCAGCGTGGCTCCGTCTCTTATCCGTCTCCTCTTTCACGATTGCTTCATCGAG
GTCAGATTTTCTGATATC
TGGCTTTCCCTTTCTTGTAATTTTGATTTCGCTAAGCTCGATCTGTGGAAGATTGTTTGGGATCTTGTTTCGGGAATGTTCGATTGTGATATCTCTATCTCAGATTTGAGTTCATATCTG
TCAGTGGAATTATGCTTTCTCAGTAGATTTTAGGTGTTTATCTCTCAATCTTGGCTACGGATATGCAGAAGTTATGTGTTTGATACTCAAGTTTTGATGTTATTAGCATGCTTTGTGAAT
CAAATACGGATATGCAGAAGTTATGTGTTTGATCCTCAGATTTGCTCATGTTACAGTTTGGATTTGCTCAGTTTTTATCAAATTCTGTGTTTTCTTTAGCACTTGTTGTAGTTTGCTCAT
GCTACAATTTGGTGAATTGTGTTTTTGCTGCAGGGATGTGATGCATCAGTCCTTCTAGACGCAGATGAAGCACATACTTCTGAGAAAGATGCATCTCCAAACCTATCCTTGAAAGGCTTT
GATGTGATTGACGCCATTAAGTCTGAGCTAGAGAATGTCTGTCCCGGAGTTGTGTCCTGCGCCGACCTTCTTGTATTGGCAGCTAGAGAAGCAGTCCTAGTG
GTAAATTGCCTCACTCTC
TCTTCTGGTTTGTGCATGTTAATACTTCTGCAACGCTTAATAATGTCTTTGAAACTCTCAGGCTGGTGGTCCATTTTATCCTCTAGAAACTGGAAGGAAGGATAGTGCAGCAGCCTTCAG
GGAGATTGCAGAACAACAGCTTCCTGCACCAGACGCTACTCTCTCGGAGATTCTTGAAAGGTTTTCTGTCAGAGGATTCAACGAGAGAGAAACCGTCAGCTTATTTG
GTAATTTCTCACT
TTTAGATATCAACATCTCTCTTTGCTTAGCTAAATAGTGTCGTATTGGGGCATTCCTCACTTCTTGGAAATGGTTGACTCTTTGTGACATGATTCTTTTCTTCTGAATGATCTTAATGCA
GGAGCACACAGCATAGGCATCACGCATTGCACATTTTTTAAGAATCGCCTCTACAACTTCTCAGCAACCGGGAAGCCTGACCCTGAACTCAATCCAGGGTTCCTCCAAGAACTGAAAACC
AAATGCCCCTTCTCTGTCTCGGCTTCATCTCCATCTGCTTCCCCTGGCACTGGTTTACTACCGTCCTTACCTGCATCAGATTCCGAAAACAGCTACGGTATGAGCTCAGGAAAAAGGAAC
GATGAAGTGATTGACTTGAGCTACAACAATGAAGGTGGTGATGAAAATTTTGGAACACGCTACTTCAGAAGACTGATGCAGAAGAAAGGGTTGCTGTTTTCTGACCAGCAACTAATGGGT
AGTGAGGTGACTGAGATGTGGGTGAGGGCATATGCTTCTGATCCTCTGTTGTTCCGCAGAGAATTTGCTATGTCTATGATGAAACTGTCAAGCAATCATGTTTTGACTGGTCCACTAGGA
CAAGTGAGAACAAGCTGCTCAAAGGCCCTCCCGAGGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTCTCGGAGACTACAAGATCGCTTTACTTACTTGCTCCGTTATCGCTCTCAGCATCTACTTTGCGATTAAAGGCGTCGAATTTCGTTTCGCGAACGATTCACCGGGAAATCGT
AACGGAGGTAAGGTTTCCGAGAAATCTCTCTTCGAAGATGAATTCATGTACATGTCAATCGCTGAAGATATCGATCGATCTCACCTCCACTACGATTACTACCGTGAATCTTGCCCTACC
GCCGAGAAAATCATCGCGAAAGCTAGCAGAGATATCTACAATGTCACACCCAGCGTGGCTCCGTCTCTTATCCGTCTCCTCTTTCACGATTGCTTCATCGAG
GGATGTGATGCATCAGTC
CTTCTAGACGCAGATGAAGCACATACTTCTGAGAAAGATGCATCTCCAAACCTATCCTTGAAAGGCTTTGATGTGATTGACGCCATTAAGTCTGAGCTAGAGAATGTCTGTCCCGGAGTT
GTGTCCTGCGCCGACCTTCTTGTATTGGCAGCTAGAGAAGCAGTCCTAGTG
GCTGGTGGTCCATTTTATCCTCTAGAAACTGGAAGGAAGGATAGTGCAGCAGCCTTCAGGGAGATTGCA
GAACAACAGCTTCCTGCACCAGACGCTACTCTCTCGGAGATTCTTGAAAGGTTTTCTGTCAGAGGATTCAACGAGAGAGAAACCGTCAGCTTATTTG
GAGCACACAGCATAGGCATCACG
CATTGCACATTTTTTAAGAATCGCCTCTACAACTTCTCAGCAACCGGGAAGCCTGACCCTGAACTCAATCCAGGGTTCCTCCAAGAACTGAAAACCAAATGCCCCTTCTCTGTCTCGGCT
TCATCTCCATCTGCTTCCCCTGGCACTGGTTTACTACCGTCCTTACCTGCATCAGATTCCGAAAACAGCTACGGTATGAGCTCAGGAAAAAGGAACGATGAAGTGATTGACTTGAGCTAC
AACAATGAAGGTGGTGATGAAAATTTTGGAACACGCTACTTCAGAAGACTGATGCAGAAGAAAGGGTTGCTGTTTTCTGACCAGCAACTAATGGGTAGTGAGGTGACTGAGATGTGGGTG
AGGGCATATGCTTCTGATCCTCTGTTGTTCCGCAGAGAATTTGCTATGTCTATGATGAAACTGTCAAGCAATCATGTTTTGACTGGTCCACTAGGACAAGTGAGAACAAGCTGCTCAAAG
GCCCTCCCGAGGAACTGA

Retrieve as FASTA