Entry information : AlyPrx12
Entry ID 7493
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx12
Name AlyPrx12
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx12
start..stop
S start..stop
AhalPrx49 728 0 1..359 1..358
AtPrx12 707 0 1..359 1..358
CrubPrx12 705 0 1..355 1..355
BstrPrx46 692 0 1..359 1..360
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14990857..14991123 267 N° 2 14992207..14992401 195 N° 3 14992506..14993123 618  
join(14990857..14991123,14992207..14992401,14992506..14993123)


exon

Literature and cross-references AlyPrx12
DNA ref. Phytozome 12:   scaffold_2 (14990857..14993123)
Protein sequence: AlyPrx12
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   359 (328)
PWM (Da):   %s   39345.13 (35981.3) Transmb domain:   %s   o4-26i
PI (pH):   %s   8.39 (8.21) Peptide Signal:   %s   cut: 32 range:32-359
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKAYPTRVLTFLMLISLMAVTLNLLSTAEAKKRRRDVPIVKGLSWNFYQKACPKVENIIKKELKKVFKRDIGLAAAILRIHFHDCFVQGCEASVLLAGSASGPGEQSSIPNLTLRQQAFVVINNLRALVQKECGQVVSCSDILALAARDSVVLSGGPDYAVPLGRRDSLAFASQETTLNNLPPPFANASQLIADFASRNLNITDLVALSGGHTIGIAHCPSFTDRLYPNQDPTMSQFFANSLKRTCPTANSSNTQVNDIRSPDVFDNKYYVDLMNRQGLFTSDQDLFVDKRTRGIVESFAINQQLFFDHFTVAMIKMGQMSVLTGTQGEIRSNCSARNTQSFMSVLEEGIEEAVVSMI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGGCTTATCCAACACGTGTCCTCACGTTTCTGATGTTGATCTCGCTAATGGCGGTGACACTGAACCTTTTGTCCACCGCAGAGGCAAAGAAGCGGAGAAGAGATGTTCCTATA
GTGAAAGGTCTCTCATGGAACTTTTACCAGAAAGCATGTCCGAAAGTCGAAAACATTATCAAAAAAGAGCTCAAAAAAGTCTTCAAGAGAGACATTGGTTTAGCCGCAGCCATCCTTCGT
ATACATTTCCATGATTGCTTCGTTCAG
GTTCAATCTTTATTTACTTTTGTTTTGTTTCTTGTATTAAAACATACGAAAACTTAATTTGATTCTTTAAGCCTACTCTAAAAGGTTCTACGT
ATGTAATTACATATTCTTTCATTAGTAAAAAAAAAACACTGGTTTTTTAAATATAAGAAACCATATCCACTCATCACTCATTATACCCACACAAAAAAAGGGATTCGGGTTGTGGATCCG
AACAAAGATGAAAATGAGATATAATTGATACAGGTTTGACTTTTATTTTTAAAATCCGACCAAAATAGCCTTAAAGAAAAGAAAAAACACAACATCGCCTCGAAATTCAAGGAATAAGGG
TTGTCAGCTTCTTACTTTAATTTCGTTTCAAAACATTAATGGTTTCTTAGTGTAAACAGAAATTAAGTGACGAAGATATTATCGAATAGTATTGTTTAATACTATTACGTTAATATTTAA
CCCATGCAACAGTGTTTACCGCAAAAAAAATTACCCAAAAAAAAAACCACTAAAACATGCAATAGGATTGACTTAAATGTATAAGGATATGTCGCATTAATACTATTCACCGGCTTTCCG
TATGTTAGTTGAATCTCAGTTATGGAACGTAACTATCATAAATAATTCAATATCCAGCCAATAATAGAAATAATAATTTTTTTTTAATAGAAATAATAAATATCAGGATACGATAGCATA
TGTGAATTATTTATTTGGATATCAACATTTAATAAATCCAATTTTCTGTAGAAAATATCTGATATTTCCTCTAGCCAAATACTAAACCTAATTTTTTTGCAGCACTACTAATGATAATCA
GATATTCATATTTCATAGTCTTACTTGCATGCAACACCTTTTATATACTTAAGAACTAAATATTATCAATAATTATGAGATGTGGCATAATTTGATTAGCTATATAATTTCGGAGGAAAC
TTCTGAAAGTAGTTTTCATATATATTTTTCTGTTATGAGATTTTTTTTTATTAAAATTTGTCTGTTATGAGAAAATTAATAAACATTTTTATTTTATTTTTTGAGCAAAGAGAAATTAAT
AAACTAAGATAATGTTTTTAAAATAAACAGGGATGTGAAGCATCAGTGCTGCTAGCTGGATCAGCCAGTGGACCAGGAGAACAATCATCAATCCCGAACCTGACGCTACGTCAACAAGCC
TTTGTCGTCATCAATAACCTTCGTGCCCTCGTCCAAAAGGAGTGTGGTCAAGTCGTCTCTTGCTCCGATATCCTCGCTCTCGCCGCCCGCGACTCCGTCGTCCTA
GTAATCACATCTCTC
TCTCTCTCTTTTATGACTACGCGGTGTCACACTAATACAAATCATTAGCTTACATTAATTGATAATTATTTTTTTGTGTGTCAATGTAGTCAGGAGGGCCAGACTATGCTGTGCCACTTG
GCCGACGTGACTCACTGGCGTTCGCGAGCCAGGAAACGACGTTAAATAACTTACCACCACCGTTCGCCAACGCGAGCCAGCTCATCGCCGACTTCGCCAGCAGAAACCTCAACATCACCG
ACTTAGTAGCACTTTCCGGTGGTCACACCATCGGAATTGCACATTGTCCATCTTTCACAGACCGGCTCTACCCGAACCAAGACCCAACCATGAGCCAGTTCTTCGCCAACAGCCTCAAAC
GCACTTGTCCCACGGCGAACTCGAGCAACACGCAAGTGAATGACATAAGGAGTCCTGACGTGTTTGACAACAAGTACTATGTTGATCTCATGAACCGACAAGGGCTGTTTACTTCTGACC
AGGATCTGTTCGTGGACAAGAGGACACGTGGTATTGTGGAGAGCTTTGCGATTAACCAGCAGCTGTTTTTTGATCATTTTACGGTGGCGATGATCAAGATGGGTCAGATGAGTGTCTTGA
CGGGGACACAAGGAGAGATTCGTTCCAACTGTTCAGCCAGAAACACCCAAAGTTTCATGTCCGTTTTGGAAGAAGGCATAGAGGAAGCTGTTGTTTCCATGATCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGGCTTATCCAACACGTGTCCTCACGTTTCTGATGTTGATCTCGCTAATGGCGGTGACACTGAACCTTTTGTCCACCGCAGAGGCAAAGAAGCGGAGAAGAGATGTTCCTATA
GTGAAAGGTCTCTCATGGAACTTTTACCAGAAAGCATGTCCGAAAGTCGAAAACATTATCAAAAAAGAGCTCAAAAAAGTCTTCAAGAGAGACATTGGTTTAGCCGCAGCCATCCTTCGT
ATACATTTCCATGATTGCTTCGTTCAG
GGATGTGAAGCATCAGTGCTGCTAGCTGGATCAGCCAGTGGACCAGGAGAACAATCATCAATCCCGAACCTGACGCTACGTCAACAAGCCTTT
GTCGTCATCAATAACCTTCGTGCCCTCGTCCAAAAGGAGTGTGGTCAAGTCGTCTCTTGCTCCGATATCCTCGCTCTCGCCGCCCGCGACTCCGTCGTCCTA
TCAGGAGGGCCAGACTAT
GCTGTGCCACTTGGCCGACGTGACTCACTGGCGTTCGCGAGCCAGGAAACGACGTTAAATAACTTACCACCACCGTTCGCCAACGCGAGCCAGCTCATCGCCGACTTCGCCAGCAGAAAC
CTCAACATCACCGACTTAGTAGCACTTTCCGGTGGTCACACCATCGGAATTGCACATTGTCCATCTTTCACAGACCGGCTCTACCCGAACCAAGACCCAACCATGAGCCAGTTCTTCGCC
AACAGCCTCAAACGCACTTGTCCCACGGCGAACTCGAGCAACACGCAAGTGAATGACATAAGGAGTCCTGACGTGTTTGACAACAAGTACTATGTTGATCTCATGAACCGACAAGGGCTG
TTTACTTCTGACCAGGATCTGTTCGTGGACAAGAGGACACGTGGTATTGTGGAGAGCTTTGCGATTAACCAGCAGCTGTTTTTTGATCATTTTACGGTGGCGATGATCAAGATGGGTCAG
ATGAGTGTCTTGACGGGGACACAAGGAGAGATTCGTTCCAACTGTTCAGCCAGAAACACCCAAAGTTTCATGTCCGTTTTGGAAGAAGGCATAGAGGAAGCTGTTGTTTCCATGATCTAG

Retrieve as FASTA