Entry information : AlyPrx01-2
Entry ID 7496
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx01-2
Name AlyPrx01-2
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx01-2
start..stop
S start..stop
CrubPrx51 568 0 1..318 1..318
BrPrx01-1Aa_other 556 0 1..319 1..320
BstrPrx27 551 0 1..318 1..318
CagraPrx73 548 0 1..318 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1833656..1833865 210 N° 2 1833391..1833576 186 N° 3 1833139..1833298 160 N° 4 1832625..1833061 437
complement(join(1832625..1833061,1833139..1833298,1833391..1833576,1833656..1833 865))


exon

Literature and cross-references AlyPrx01-2
DNA ref. Phytozome 12:   scaffold_1 (1833865..1832625)
Protein sequence: AlyPrx01-2
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (309)
PWM (Da):   %s   35973.95 (33842.6)  
PI (pH):   %s   9.95 (9.87) Peptide Signal:   %s   cut: 22 range:22-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIKNLLALVVLLNVLGVSVAQKGLDLNYYKHRCPDVEAIVLRVTVQYVSRQPSLAAALLRLHFHDCFVRGCDGSVLLRSRDNDAEINALPSLSLRGFEVVDAAKSAVEKKCPGVVSCADILALVARDAVSVINGPSWPVPLGRRDGRISRRSEVNLPSPFAGIAALKQGFFAKGLNTTDLVVLSGGHTIGISNCGLINKRIYNFTGKGDFDPSMNPSYVRKLKKRCKPNDFKTPVEMDPGSVKKFNSHYFDNVAQKKGLFTSDSTLLDDPETKSYIDRQVATAGSSFPKDFSDSMVKLGFVQILTGEKGEIRKRCAFVKPKTKETLTFL

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 1, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATAAAGAACCTTCTTGCTCTTGTGGTTCTTCTAAATGTCCTTGGAGTATCAGTTGCTCAAAAGGGTCTTGACCTTAACTATTACAAACACAGGTGTCCTGACGTTGAAGCTATT
GTCCTCCGTGTCACAGTTCAATATGTTTCTCGCCAGCCGAGTCTTGCTGCCGCGCTTCTAAGGTTGCATTTTCATGATTGTTTCGTCAGA
GTAGGTTTGCTTCTCTGAGACTATACTTAG
TAAATATATGTGTGGAAAACACTGCTAACATTTTTGATGGTTCATGTAGGGATGTGATGGTTCCGTTCTTCTAAGATCTCGAGACAATGATGCGGAAATAAACGCTCTCCCCAGCCTGTC
CCTTAGAGGCTTTGAAGTGGTCGATGCCGCCAAGTCAGCGGTCGAGAAGAAATGTCCCGGAGTGGTTTCTTGCGCTGATATTCTCGCCTTAGTGGCGAGAGACGCCGTCTCAGTG
GTACA
TAACATTTCATAATGGACAGATTCTTCTCATTCCAAATCATTGAAATTAGAGTACTAAAACTTCTTTTTTTTTTTGCCTTTTCACAGATCAACGGACCAAGTTGGCCAGTTCCATTGGGT
CGGAGGGATGGTCGCATCTCAAGACGTTCCGAGGTTAACTTACCTTCGCCTTTCGCTGGAATAGCTGCCCTGAAACAGGGCTTCTTCGCCAAGGGTCTTAACACTACAGACCTCGTCGTT
CTCTCAG
GTTCTACAAATACCTTATACATATAGTGCAATCTAAAAGTTACCAACTTGAATAATATATAATGGTTTCTTGGGCAGGAGGTCACACCATTGGAATCTCTAATTGCGGTCTCA
TCAACAAGCGTATCTACAACTTTACGGGCAAAGGCGATTTTGACCCGTCCATGAATCCGAGCTACGTCAGGAAATTGAAGAAAAGGTGCAAGCCTAATGATTTTAAGACCCCAGTGGAGA
TGGACCCAGGCAGTGTCAAGAAGTTCAACTCTCACTACTTCGACAATGTGGCTCAAAAGAAGGGTTTGTTCACATCTGACTCAACACTTCTCGATGATCCTGAGACCAAAAGCTATATCG
ATAGACAGGTTGCTACCGCTGGCTCTTCATTCCCCAAAGATTTCTCCGATTCGATGGTCAAACTTGGTTTCGTCCAAATTCTTACCGGGGAAAAGGGTGAGATCAGGAAGAGATGCGCCT
TCGTTAAACCCAAAACTAAAGAGACACTCACATTTCTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATAAAGAACCTTCTTGCTCTTGTGGTTCTTCTAAATGTCCTTGGAGTATCAGTTGCTCAAAAGGGTCTTGACCTTAACTATTACAAACACAGGTGTCCTGACGTTGAAGCTATT
GTCCTCCGTGTCACAGTTCAATATGTTTCTCGCCAGCCGAGTCTTGCTGCCGCGCTTCTAAGGTTGCATTTTCATGATTGTTTCGTCAGA
GGATGTGATGGTTCCGTTCTTCTAAGATCT
CGAGACAATGATGCGGAAATAAACGCTCTCCCCAGCCTGTCCCTTAGAGGCTTTGAAGTGGTCGATGCCGCCAAGTCAGCGGTCGAGAAGAAATGTCCCGGAGTGGTTTCTTGCGCTGAT
ATTCTCGCCTTAGTGGCGAGAGACGCCGTCTCAGTG
ATCAACGGACCAAGTTGGCCAGTTCCATTGGGTCGGAGGGATGGTCGCATCTCAAGACGTTCCGAGGTTAACTTACCTTCGCCT
TTCGCTGGAATAGCTGCCCTGAAACAGGGCTTCTTCGCCAAGGGTCTTAACACTACAGACCTCGTCGTTCTCTCAG
GAGGTCACACCATTGGAATCTCTAATTGCGGTCTCATCAACAAG
CGTATCTACAACTTTACGGGCAAAGGCGATTTTGACCCGTCCATGAATCCGAGCTACGTCAGGAAATTGAAGAAAAGGTGCAAGCCTAATGATTTTAAGACCCCAGTGGAGATGGACCCA
GGCAGTGTCAAGAAGTTCAACTCTCACTACTTCGACAATGTGGCTCAAAAGAAGGGTTTGTTCACATCTGACTCAACACTTCTCGATGATCCTGAGACCAAAAGCTATATCGATAGACAG
GTTGCTACCGCTGGCTCTTCATTCCCCAAAGATTTCTCCGATTCGATGGTCAAACTTGGTTTCGTCCAAATTCTTACCGGGGAAAAGGGTGAGATCAGGAAGAGATGCGCCTTCGTTAAA
CCCAAAACTAAAGAGACACTCACATTTCTTTGA

Retrieve as FASTA