Entry information : AlyPrx42(AL7G31740)
Entry ID 7497
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-02-26 (Christophe Dunand)
Peroxidase information: AlyPrx42(AL7G31740)
Name AlyPrx42(AL7G31740)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx42
start..stop
S start..stop
AtPrx42 681 0 1..330 1..330
CrubPrx94 678 0 1..330 1..330
CagraPrx65 678 0 1..330 1..330
AhalPrx24 677 0 1..330 1..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8894562..8894789 228 N° 2 8894913..8895101 189 N° 3 8895198..8895363 166 N° 4 8895836..8896245 410
join(8894562..8894789,8894913..8895101,8895198..8895363,8895836..8896245)


exon

Literature and cross-references AlyPrx42(AL7G31740)
DNA ref. Phytozome 12:   scaffold_7 (8894562..8896245)
Protein sequence: AlyPrx42(AL7G31740)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (307)
PWM (Da):   %s   37133.98 (34813.8)  
PI (pH):   %s   7.77 (7.81) Peptide Signal:   %s   cut: 24 range:24-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGGKGVMMVAILCLWALSATSEAVTEEAPGLMMNFYKDTCPQAEDIIREQVKLLYKRHKNTAFSWLRNIFHDCAVESCDASLLLDSTRRELGEKEHDRSFGLRNFRYIEEIKEALERECPGVVSCSDILVLSAREGIEAVGGPYIPLKTGRRDGLKSRTDMLESYLPDHNESISVVLDKFKSIGIDTPGLVALLGSHSVGRTHCVKLVHRLYPEVDPSLNPDHVPHMLHKCPDSIPDPKAVQYVRNDRGTPMVLDNNYYRNILDNKGLLLVDHQLAHDKRTRPIVKKMAKDQAYFFKEFTRAIQILSENNPLTGSKGEIRKQCNLANKNH

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 7, 3 introns).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATCTTGCAG GCCCCATGGT GAAGGCAACG TTAAGGACAC GGATGAGTAC AGTGTCCACT TGTCAGATGA AGATCCATGG TTAACTACTT ACTAACTTGT CTGAATTCAA TTTTAATAAC  CGGTAATCTA ATGATACCGG TTATTATCAT CATGTACTCA ACAATTTTAC ATCAATTTTT TAGTTAGAAC TTGCTAATCG GTGTTTAGCA CTCGTGGAGC CACTGAGCGA GAGAGTGACA  TTACTGAGAA GGTCCCCACA GACTCATTTG GCGACACTTG GATAAGGAAA CAAAGTGTCG GTGGTCACAG TACTTCGTTT TTATTGGAAA ATCAAAATAT CCAAATATGA GGTGAATTTT  GAATCTACGG ATTCAATGTG ATCTTGGTAA AAGCACCGAT ACTTCTCCCA GATTAAAAAA TAAAAAAAGT TCTAGGATTA AGAAAAGAAG AAGAATAGAA TTTGTAGTAA CCTCTCATTT  TATAGCTGTG TAATATATAT AGGATATATA ATCTCTTTTA TACATATTTC CATATTTAGT TCATTTTAAA CATTCTCATC AAAATTCCAA AGCTAATGAT AGTGGCTTTA TTCAAAATTA  GCTAAAAATA TGAAAGAGAA CATAATTCCA GGATTTCCTT ATTTTTGTAG GGACATAATA TATTTAGTAT ATACCTAATA AATTTTGAAG TTAATGTGAA AAATATTAAA ACAACGTTTG  TTAAAAACAT ATGAAAACTT CTAAATGCAC TATGAACTAG TACAATCATT ATTTAAATTC AACACACAAA ACAGATAAAG CATAGGGAAC ACTCAAGAGT GAAGAGTGGT GAACGTGTTT  TAATAGCTCA TCACATGGAT CAAGATTCAT TCAATATATG AGAAGACTTT ACATTTCATA ACTCTCTACT GACAATTACT ACATTAAGTA AAACAGTTTA ATACTATAAA TAATTTCAGA  ACAAAAATGT AATTGAATAT GTACAAATGG AATTATATTT TAGATTAAAT AATCGACATG TACTTGGAAA AAATAAGAAC CCACCTTGAG TTCATCGAAA AGAAAGATTC CGTAACATAA  AGGAGCGGTT TATCCGCTGT ATTAAAAGTT TAACAATAAA AAACGTTTTC AGATAATTGC AAATCGACCC GTGAACATTT CTTAACTTTA GCTATTAAAC CCCATAAATA ATATTTGTTA  TAGCCGCCCC CCTTTGTTTG TATTAACAAA AGAAGCAGAT TTTTTTTGTA ATGTTCTTTA CTCTACAGTC ATAGGGGCCA CTGATGCACT CAATGAGACC AAAATCCAAA ACTTTACTAA  ATGTGAATAA TGGTTTTGCT AACCAGAACA CTGAACACCC TTCCAAATGG GGTAAATTAT CTAAAATGCC ATCCACATTA AAATCTCCAA CTAACTTATT TATTTGATCA TAGCACTGTA  TAGGACTCTA ACTAGCAATT GTCTAGCATG ATCTACGATT CCTCACACGT CCTTCCAAAT AGTAACAAAG TGTGGTTTTA GATTTCTTAC CCAAATTAAA TTTTCAGTAC TATGTCTGGC  ATATATTTGA TGGAACTTTA AAATAAAATG AGTAATTTCA AGTGAAACTC CACAAGTTAC TAAATCAAAT TTTAGAAAAT AAATGTCAAG GCAACAGTCA ATATGAATTA TCAACTTTTT  TTTGTTTACA TATAATTTTT TTTATAATAA GTCTACACTT TTCATTGAAT ATAGTAATAA TATTTCTCAA AGTGAAAATG AATAAAGCTT AATGATATAT GTATGATCTG TCACGTAAAC  TTATAGAAAC AGTAGCACAT TCTGACATCA ACCAACTTGC CTTAATTTAC TATAACCTTC AAATTAATTT TTAATTTTCA TTTTCTCGTT CAAAAATAAA ATAAAAATAA AGAAAACTCC 
ATTTTCCTTT ATTTAAGGAG GCTGCATTGC TTGCCCACTG ACTCAACTCA AGAGTGAAGA AAGAAAGAGA CAAAAAAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGCAAAGGTGTGATGATGGTGGCGATACTTTGCCTTTGGGCACTCTCTGCAACATCTGAAGCAGTAACAGAGGAGGCTCCAGGTTTGATGATGAACTTCTACAAGGACACGTGT
CCTCAGGCCGAAGACATCATCCGTGAACAAGTCAAACTCCTCTACAAACGCCACAAGAACACCGCTTTCTCTTGGCTACGTAACATCTTCCACGACTGCGCCGTCGAG
GTCTGATCTCTT
TCCCTCTCTCTCAATGATCTTTGTGTTAAAACATAGCTAAAGGTTTGATCTTTCACTTGAAACAGAGCTAACGATTTACTCTGTTTTTGCTATGTTTTTTGAGTGTAACAGTCGTGTGAT
GCGTCGCTTTTGCTGGATTCGACAAGAAGAGAGCTAGGAGAGAAAGAACATGACAGGAGCTTCGGACTGAGAAACTTCAGGTACATCGAGGAGATCAAGGAAGCTCTAGAGAGGGAGTGT
CCTGGTGTTGTCTCATGTTCTGACATTCTCGTCTTGTCGGCAAGAGAAGGAATCGAAGCA
GTAAGTTAAAACAAGTCGTGCCGTTTCTGTCTCTGGTTGTGAAACTGCATGTTTTCTTTT
TAGGGAATGTTTTGTAAAGTAGGTTTGTTTGTGTAGGTGGGAGGACCATATATTCCTTTGAAGACAGGAAGGAGAGATGGACTTAAAAGCAGGACCGATATGCTTGAGTCATATCTTCCC
GACCACAACGAGAGTATCTCCGTCGTTCTTGACAAGTTCAAATCCATCGGAATCGACACTCCCGGCCTCGTTGCTCTCCTAG
GTACCTTTACCTTTCTCTTCCTTGTTTGTCACTCACTA
GTCTCGGGTAAAAACGTATCGCTCGAAATTCGAAACTGTTGACCATCCAAGAAATGTTGTTGGCTTGTTGCTAACGCCTTAGTTCAAGGGTATTTTAGTTAATTTCCTCATGCATTAAAA
TGAAACCATTTAAGCTAATCTTGTCAAATCACGAAAGTAGTATGCTATCTGAGTCGGAAAGTTGAAAGTTATCCTTACCGAACTATCACTAGTCCTCAGAAAAAGACAAATTTATTCTTG
TTTATGCTCCGGCTCAATGGTCTAGCAGAAGGTTATTCTGGTCAATCAACTCATGCATGCTTAAAAATAGTAATCAAACTAATTGACTTTACACTTATGGGATCTGAATTTAGGCGATCG
GAATTTAAGTTTCTTGTTAGATTTTTTAAGCTTCGATATTGAAAGATTTTGACTTTTTGTTTTGACACGTGCAGGGTCACATAGCGTGGGAAGAACTCACTGTGTCAAGCTGGTCCATCG
TTTGTACCCTGAGGTGGATCCGTCCTTGAACCCGGACCACGTCCCTCACATGCTACATAAGTGTCCTGACTCTATCCCTGACCCAAAGGCGGTCCAGTACGTGCGTAACGACCGTGGTAC
CCCCATGGTGCTAGACAACAATTACTACCGTAACATCCTAGACAACAAGGGTTTGCTTCTTGTGGACCATCAGCTCGCACACGACAAAAGAACTAGACCAATTGTTAAGAAGATGGCTAA
GGACCAGGCCTACTTCTTCAAGGAGTTCACTAGGGCAATCCAGATCTTATCCGAGAACAACCCTTTGACTGGCTCTAAGGGTGAGATCAGGAAGCAATGCAACCTTGCAAACAAGAACCA
TTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGCAAAGGTGTGATGATGGTGGCGATACTTTGCCTTTGGGCACTCTCTGCAACATCTGAAGCAGTAACAGAGGAGGCTCCAGGTTTGATGATGAACTTCTACAAGGACACGTGT
CCTCAGGCCGAAGACATCATCCGTGAACAAGTCAAACTCCTCTACAAACGCCACAAGAACACCGCTTTCTCTTGGCTACGTAACATCTTCCACGACTGCGCCGTCGAG
TCGTGTGATGCG
TCGCTTTTGCTGGATTCGACAAGAAGAGAGCTAGGAGAGAAAGAACATGACAGGAGCTTCGGACTGAGAAACTTCAGGTACATCGAGGAGATCAAGGAAGCTCTAGAGAGGGAGTGTCCT
GGTGTTGTCTCATGTTCTGACATTCTCGTCTTGTCGGCAAGAGAAGGAATCGAAGCA
GTGGGAGGACCATATATTCCTTTGAAGACAGGAAGGAGAGATGGACTTAAAAGCAGGACCGAT
ATGCTTGAGTCATATCTTCCCGACCACAACGAGAGTATCTCCGTCGTTCTTGACAAGTTCAAATCCATCGGAATCGACACTCCCGGCCTCGTTGCTCTCCTAG
GGTCACATAGCGTGGGA
AGAACTCACTGTGTCAAGCTGGTCCATCGTTTGTACCCTGAGGTGGATCCGTCCTTGAACCCGGACCACGTCCCTCACATGCTACATAAGTGTCCTGACTCTATCCCTGACCCAAAGGCG
GTCCAGTACGTGCGTAACGACCGTGGTACCCCCATGGTGCTAGACAACAATTACTACCGTAACATCCTAGACAACAAGGGTTTGCTTCTTGTGGACCATCAGCTCGCACACGACAAAAGA
ACTAGACCAATTGTTAAGAAGATGGCTAAGGACCAGGCCTACTTCTTCAAGGAGTTCACTAGGGCAATCCAGATCTTATCCGAGAACAACCCTTTGACTGGCTCTAAGGGTGAGATCAGG
AAGCAATGCAACCTTGCAAACAAGAACCATTGA

Retrieve as FASTA