Entry information : AlyPrx66
Entry ID 7500
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx66
Name AlyPrx66
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx66
start..stop
S start..stop
AtPrx66 642 0 1..322 1..322
BstrPrx29 634 0 1..322 1..322
CagraPrx80 633 0 1..322 1..322
CrubPrx95 625 0 1..322 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14798174..14798386 213 N° 2 14797885..14798073 189 N° 3 14797077..14797643 567  
complement(join(14797077..14797643,14797885..14798073,14798174..14798386))


exon

Literature and cross-references AlyPrx66
DNA ref. Phytozome 12:   scaffold_8 (14798386..14797077)
Protein sequence: AlyPrx66
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (298)
PWM (Da):   %s   35573.26 (32985.8)  
PI (pH):   %s   9.78 (9.67) Peptide Signal:   %s   cut: 25 range:25-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKVLIFAMTIVVLAIVRPSEAALDAHYYDRSCPAAEKIILETVRNATLYDPKVPARLLRMFFHDCFIRGCDASILLDSTWSNQAEKDGPPNISVRSFYVIEDAKRKLEKACPRTVSCADVIAIAARDVVTLSGGPYWSVLKGRKDGTISRANETRNLPAPTFNVSQLIQSFAARGLSVKDMVTLSGGHTIGFSHCSSFESRLQNFSKLHDIDPSMNYEFAQTLKRKCPRSSNRGKNAGTVLDSTSSVFDNVYYKQILSGKGVFGSDQALLGDSRTKWIVETFARDQKAFFREFAASMVKLGNFGVKETGQVRVNTRFVN*

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 8, introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCTCGAAAGTACTCATTTTCGCGATGACCATTGTGGTTTTGGCGATAGTTAGGCCCTCAGAAGCTGCCCTTGATGCTCATTACTATGATCGATCGTGCCCCGCTGCTGAAAAA
ATCATACTTGAAACTGTTAGGAATGCTACTTTGTATGATCCCAAAGTGCCTGCTCGTCTCCTCAGAATGTTCTTCCACGATTGCTTCATCAGG
GTATGCATCTTGATCTTCTTTCTTTGA
TCGTCGCTAATTGATTATCCAGTTAGATATGAAGTTGAATTTTGAGTAAATTATTTGGTTTGTGTTGTTGTAGGGATGTGATGCGTCCATTCTACTTGATTCGACATGGTCAAACCAAGC
TGAGAAGGATGGTCCTCCTAACATCTCGGTACGGTCATTTTACGTGATCGAAGATGCTAAGAGAAAGCTCGAAAAGGCTTGTCCTCGTACCGTGTCTTGTGCCGATGTAATCGCCATTGC
AGCCAGAGATGTGGTCACCCTG
GTGAGTATTCGTAATAGAGTGGTCCCTTTATGATCCCTATAAACTAAAAACCAAACAGAGACCACTTAAATTACATTTTGTGTTCATTTAAAAGCAAT
CTAATCAAGAATTTAAATATTTTATGACCAATCTATATTATATTTGTGTAATATGATTCGATTACGGTCTTAACGTTTTGGTTTGAATTTTGTTCTATTTGATTTATTTGTCCATGCCTC
TTGTAATGTTTTTCATTTATTAGTCCGGTGGTCCTTATTGGAGCGTACTGAAAGGGCGAAAAGACGGGACAATTTCGCGAGCCAACGAGACTAGAAATCTCCCAGCACCAACGTTTAATG
TTTCTCAACTGATCCAAAGCTTTGCAGCAAGAGGATTGTCGGTGAAAGACATGGTTACACTCTCAGGTGGCCACACCATAGGGTTCTCTCACTGTTCTTCTTTCGAGTCCCGTCTTCAAA
ACTTTAGCAAATTGCACGACATTGATCCTTCGATGAACTATGAGTTCGCACAAACCCTGAAAAGGAAATGTCCGAGATCATCTAACCGAGGCAAGAACGCAGGGACAGTCTTGGACTCTA
CGTCCTCGGTTTTCGACAATGTTTACTACAAGCAGATTTTGTCCGGGAAAGGAGTGTTTGGGTCTGATCAGGCCCTTCTAGGCGATTCTCGGACTAAGTGGATCGTTGAGACGTTTGCTC
GAGACCAAAAAGCTTTCTTCAGAGAGTTTGCAGCTTCCATGGTAAAACTTGGAAACTTTGGAGTCAAGGAGACCGGACAAGTGAGAGTTAACACTCGCTTCGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCTCGAAAGTACTCATTTTCGCGATGACCATTGTGGTTTTGGCGATAGTTAGGCCCTCAGAAGCTGCCCTTGATGCTCATTACTATGATCGATCGTGCCCCGCTGCTGAAAAA
ATCATACTTGAAACTGTTAGGAATGCTACTTTGTATGATCCCAAAGTGCCTGCTCGTCTCCTCAGAATGTTCTTCCACGATTGCTTCATCAGG
GGATGTGATGCGTCCATTCTACTTGAT
TCGACATGGTCAAACCAAGCTGAGAAGGATGGTCCTCCTAACATCTCGGTACGGTCATTTTACGTGATCGAAGATGCTAAGAGAAAGCTCGAAAAGGCTTGTCCTCGTACCGTGTCTTGT
GCCGATGTAATCGCCATTGCAGCCAGAGATGTGGTCACCCTG
TCCGGTGGTCCTTATTGGAGCGTACTGAAAGGGCGAAAAGACGGGACAATTTCGCGAGCCAACGAGACTAGAAATCTC
CCAGCACCAACGTTTAATGTTTCTCAACTGATCCAAAGCTTTGCAGCAAGAGGATTGTCGGTGAAAGACATGGTTACACTCTCAGGTGGCCACACCATAGGGTTCTCTCACTGTTCTTCT
TTCGAGTCCCGTCTTCAAAACTTTAGCAAATTGCACGACATTGATCCTTCGATGAACTATGAGTTCGCACAAACCCTGAAAAGGAAATGTCCGAGATCATCTAACCGAGGCAAGAACGCA
GGGACAGTCTTGGACTCTACGTCCTCGGTTTTCGACAATGTTTACTACAAGCAGATTTTGTCCGGGAAAGGAGTGTTTGGGTCTGATCAGGCCCTTCTAGGCGATTCTCGGACTAAGTGG
ATCGTTGAGACGTTTGCTCGAGACCAAAAAGCTTTCTTCAGAGAGTTTGCAGCTTCCATGGTAAAACTTGGAAACTTTGGAGTCAAGGAGACCGGACAAGTGAGAGTTAACACTCGCTTC
GTCAACTAA

Retrieve as FASTA