Entry information : AlyPrx35
Entry ID 7501
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx35
Name AlyPrx35
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx35
start..stop
S start..stop
CagraPrx07 654 0 1..329 1..329
CrubPrx102 650 0 1..329 1..329
BstrPrx76 644 0 1..329 1..329
AtPrx35 639 0 1..329 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14858217..14858432 216 N° 2 14857916..14858116 201 N° 3 14857555..14857720 166 N° 4 14857061..14857467 407
complement(join(14857061..14857467,14857555..14857720,14857916..14858116,1485821 7..14858432))


exon

Literature and cross-references AlyPrx35
DNA ref. Phytozome 12:   scaffold_5 (14858432..14857061)
Protein sequence: AlyPrx35
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (309)
PWM (Da):   %s   35780.4 (33654.2)  
PI (pH):   %s   9.63 (9.62) Peptide Signal:   %s   cut: 21 range:21-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARFGIVLVISLCLTISVLPDTTIAQLSRGFYSKTCPNVEQIVRNAVQKKIKQTFVTVPATLRLFFHDCFVNGCDASVMIQSTPTNKAERDHPDNISLAGDGFDVVIQAKKALDANPRCQNKVSCADILTLATRDVVVAAGGPSYEVELGRFDGLVSTASSVEGNLPGPSDNVDKLNALFKKNKLTQEDMIALSAAHTLGFAHCRKVFKRIYNFNGINSVDPSLNKAYAIELQKACPKNVDPRIAINMDPVTPKTFDNTYFKNLQQGKGLFTSDQVLFTDGRSRPTVNAWASNSTAFNRAFVTAMTKLGRVGVKNSRNGNIRRDCGAFN

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 5, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGCTTCGGCATTGTTCTAGTCATATCTCTTTGCCTCACAATCTCTGTCTTGCCCGATACAACCATCGCGCAGCTAAGCCGCGGTTTCTACTCCAAAACTTGCCCCAATGTCGAA
CAAATCGTGAGAAATGCTGTCCAAAAGAAAATAAAGCAGACGTTCGTCACCGTCCCTGCCACTCTCCGTCTCTTCTTCCACGACTGCTTTGTCAAT
GTATGTTTCTATTTAAGCGTTTTC
ATATCTTTTTTTCTCCTCTTTCGTTAGGCGATTAATTGGTTTCTTAGTTCGACCTTCGATGTGATTGGCATTGTAGGGTTGTGATGCATCTGTCATGATCCAATCAACGCCTACGAACAA
GGCAGAGAGGGATCATCCAGATAACATTTCGCTGGCCGGAGATGGATTTGACGTGGTGATCCAAGCTAAGAAAGCCCTTGACGCTAACCCTCGTTGCCAAAACAAGGTCTCATGTGCCGA
TATTCTTACTTTGGCCACCCGAGATGTCGTTGTTGCG
GTGAGTATTTGTACTATATATATCCTTTCTATAACCAGATAATCCCAAAGCCAATATTCTTATCACTCTTCATAGTCTACCAA
TACTATATGTAAGAAAATAGTACATCGCTTTTGTTCAAAAATAAATAAATAGTACATCGCAATGCTTGTTGAGAAATGTTATAATATGAACCAAGGTTTTACGCATGTATAGGCTGGAGG
GCCGTCCTATGAAGTTGAACTTGGTAGGTTCGATGGTTTGGTATCAACCGCGTCTAGTGTCGAAGGGAACTTACCAGGACCTTCGGACAATGTAGACAAACTTAACGCTCTTTTCAAGAA
AAACAAACTTACCCAAGAAGATATGATTGCTCTTTCAG
GTAAACCAAATTTAAAAACAAAACATGGTATATATATTTATATCACCAAAGTGCATCGATTTCTAAACCGTTAGATTCATAA
TGTAGCGGCTCACACCCTTGGATTCGCACATTGCCGCAAGGTCTTTAAAAGAATCTACAACTTCAACGGCATCAACTCCGTGGATCCATCTCTAAACAAGGCTTACGCTATTGAGCTTCA
AAAGGCTTGTCCTAAGAATGTGGACCCAAGAATTGCAATCAACATGGACCCAGTCACGCCCAAGACGTTTGACAACACTTACTTCAAGAATCTTCAACAAGGCAAAGGTCTCTTCACCTC
CGATCAAGTTCTCTTCACGGATGGTCGCTCTAGGCCCACCGTTAATGCTTGGGCCTCAAACTCTACGGCCTTCAACCGCGCTTTTGTGACCGCCATGACCAAACTTGGCCGTGTTGGTGT
TAAGAATAGCCGCAATGGAAACATTCGTCGTGACTGTGGTGCGTTTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGCTTCGGCATTGTTCTAGTCATATCTCTTTGCCTCACAATCTCTGTCTTGCCCGATACAACCATCGCGCAGCTAAGCCGCGGTTTCTACTCCAAAACTTGCCCCAATGTCGAA
CAAATCGTGAGAAATGCTGTCCAAAAGAAAATAAAGCAGACGTTCGTCACCGTCCCTGCCACTCTCCGTCTCTTCTTCCACGACTGCTTTGTCAAT
GGTTGTGATGCATCTGTCATGATC
CAATCAACGCCTACGAACAAGGCAGAGAGGGATCATCCAGATAACATTTCGCTGGCCGGAGATGGATTTGACGTGGTGATCCAAGCTAAGAAAGCCCTTGACGCTAACCCTCGTTGCCAA
AACAAGGTCTCATGTGCCGATATTCTTACTTTGGCCACCCGAGATGTCGTTGTTGCG
GCTGGAGGGCCGTCCTATGAAGTTGAACTTGGTAGGTTCGATGGTTTGGTATCAACCGCGTCT
AGTGTCGAAGGGAACTTACCAGGACCTTCGGACAATGTAGACAAACTTAACGCTCTTTTCAAGAAAAACAAACTTACCCAAGAAGATATGATTGCTCTTTCAG
CGGCTCACACCCTTGGA
TTCGCACATTGCCGCAAGGTCTTTAAAAGAATCTACAACTTCAACGGCATCAACTCCGTGGATCCATCTCTAAACAAGGCTTACGCTATTGAGCTTCAAAAGGCTTGTCCTAAGAATGTG
GACCCAAGAATTGCAATCAACATGGACCCAGTCACGCCCAAGACGTTTGACAACACTTACTTCAAGAATCTTCAACAAGGCAAAGGTCTCTTCACCTCCGATCAAGTTCTCTTCACGGAT
GGTCGCTCTAGGCCCACCGTTAATGCTTGGGCCTCAAACTCTACGGCCTTCAACCGCGCTTTTGTGACCGCCATGACCAAACTTGGCCGTGTTGGTGTTAAGAATAGCCGCAATGGAAAC
ATTCGTCGTGACTGTGGTGCGTTTAACTAG

Retrieve as FASTA