Entry information : AlyPrx67
Entry ID 7508
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx67
Name AlyPrx67
Class Class III peroxidase    [Orthogroup: Prx055]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx67
start..stop
S start..stop
AhalPrx62 649 0 1..316 9..324
AtPrx67 588 0 1..316 1..316
CrubPrx103 569 0 1..316 1..316
CagraPrx29 568 0 1..316 9..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18559444..18559641 198 N° 2 18559151..18559342 192 N° 3 18558472..18559032 561  
complement(join(18558472..18559032,18559151..18559342,18559444..18559641))


exon

Literature and cross-references AlyPrx67
DNA ref. Phytozome 12:   scaffold_8 (18559641..18558472)
Protein sequence: AlyPrx67
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (297)
PWM (Da):   %s   34614.7 (32506.6)  
PI (pH):   %s   10.13 (10.15) Peptide Signal:   %s   cut: 20 range:20-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLKVVLLMMTMMLASQSEAQLNRDFYKESCPSLFLVVRRVVKRAVAREPRMGASLLRLFFHDCFVNGCDGSLLLDDTPSFLGEKTSGPSNNSVRGFEVIDKIKFKIEKMCPGIVSCADILAITARDSVLLLGGPGWSVKLGRRDSTTANFAAANSGVIPSPISTLSNLINRFKAQGLSTRDMVALSGAHTFGRAKCVTFRNRIYNESNIDTSFAIARRKSCPSANGSGDNKEANLDVRSPDRFDHGYYKQLLSNKGLLTSDQVLFNNGPTDSLVIAYSNNLNAFYRDFARAMIKMGDISPLTGSKGQIRHNCRRPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, introns 1 and 2)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTAAAGGTGGTGTTGTTGATGATGACAATGATGTTGGCGTCCCAATCCGAGGCTCAGCTGAACCGTGACTTTTACAAGGAAAGCTGTCCGTCATTGTTCCTTGTGGTGAGACGGGTC
GTGAAACGGGCCGTGGCCAGAGAGCCTCGCATGGGTGCTTCTCTCCTTCGTTTGTTCTTCCATGATTGTTTTGTCAAT
GTAAGTTTTTTTTTTTTTTCAATGCAAAAAAGAAGCATGCTT
AGTATTTTCCCATGAATTACTCCTAAAATTTAGTAAATGCTAACAATATGGTTTGACAGGGGTGTGACGGATCCTTACTGTTGGATGACACACCATCTTTTTTGGGAGAGAAAACCTCAG
GACCCAGCAATAACTCTGTGAGGGGGTTCGAAGTGATCGACAAAATCAAGTTTAAGATTGAGAAAATGTGCCCGGGCATCGTCTCATGCGCAGACATTCTCGCCATCACTGCTCGCGACT
CCGTTCTCCTC
GTTAGCACCTCTACCCTTTTACTCTTTAGAAACCCTTAGAACTCAGACCAAAGACGAGCATTTTATAGGGTCTTCTCATCAATCTCAATATTTAACACTTCTTAATATG
ACTAAACAGTTAGGTGGACCGGGGTGGAGCGTGAAACTTGGAAGAAGAGACTCCACAACAGCGAACTTTGCGGCCGCTAACTCTGGGGTCATTCCTTCTCCGATCAGTACCCTCAGCAAT
CTCATAAACCGTTTCAAAGCCCAAGGATTGTCCACACGTGACATGGTCGCCCTCTCTGGTGCTCACACCTTTGGACGAGCCAAATGTGTCACATTCAGAAACCGTATCTACAACGAAAGT
AACATAGACACCTCTTTCGCCATCGCAAGACGGAAGAGCTGTCCCAGCGCCAACGGCTCCGGAGACAACAAGGAAGCCAATCTTGACGTCCGCTCTCCTGATAGGTTTGACCACGGGTAC
TACAAGCAACTTCTCAGCAACAAAGGTTTGCTTACGTCAGACCAGGTCCTCTTTAACAATGGTCCCACCGACTCGCTCGTCATAGCTTACAGCAACAATCTCAACGCCTTCTACCGCGAT
TTCGCAAGAGCTATGATTAAGATGGGTGACATCAGCCCCCTCACTGGATCCAAAGGTCAGATCCGCCACAACTGTCGCAGGCCCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTAAAGGTGGTGTTGTTGATGATGACAATGATGTTGGCGTCCCAATCCGAGGCTCAGCTGAACCGTGACTTTTACAAGGAAAGCTGTCCGTCATTGTTCCTTGTGGTGAGACGGGTC
GTGAAACGGGCCGTGGCCAGAGAGCCTCGCATGGGTGCTTCTCTCCTTCGTTTGTTCTTCCATGATTGTTTTGTCAAT
GGGTGTGACGGATCCTTACTGTTGGATGACACACCATCTTTT
TTGGGAGAGAAAACCTCAGGACCCAGCAATAACTCTGTGAGGGGGTTCGAAGTGATCGACAAAATCAAGTTTAAGATTGAGAAAATGTGCCCGGGCATCGTCTCATGCGCAGACATTCTC
GCCATCACTGCTCGCGACTCCGTTCTCCTC
TTAGGTGGACCGGGGTGGAGCGTGAAACTTGGAAGAAGAGACTCCACAACAGCGAACTTTGCGGCCGCTAACTCTGGGGTCATTCCTTCT
CCGATCAGTACCCTCAGCAATCTCATAAACCGTTTCAAAGCCCAAGGATTGTCCACACGTGACATGGTCGCCCTCTCTGGTGCTCACACCTTTGGACGAGCCAAATGTGTCACATTCAGA
AACCGTATCTACAACGAAAGTAACATAGACACCTCTTTCGCCATCGCAAGACGGAAGAGCTGTCCCAGCGCCAACGGCTCCGGAGACAACAAGGAAGCCAATCTTGACGTCCGCTCTCCT
GATAGGTTTGACCACGGGTACTACAAGCAACTTCTCAGCAACAAAGGTTTGCTTACGTCAGACCAGGTCCTCTTTAACAATGGTCCCACCGACTCGCTCGTCATAGCTTACAGCAACAAT
CTCAACGCCTTCTACCGCGATTTCGCAAGAGCTATGATTAAGATGGGTGACATCAGCCCCCTCACTGGATCCAAAGGTCAGATCCGCCACAACTGTCGCAGGCCCAATTGA

Retrieve as FASTA