Entry information : AlyPrx21
Entry ID 7511
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx21
Name AlyPrx21
Class Class III peroxidase    [Orthogroup: Prx031]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx21
start..stop
S start..stop
AtPrx21 670 0 1..327 1..327
BstrPrx19 669 0 1..327 1..327
BrPrx21-1Ab_other 625 0 7..327 8..328
CrubPrx84 623 0 22..327 22..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17759250..17759325 76 N° 2 17758904..17759052 149 N° 3 17758615..17758803 189 N° 4 17758363..17758531 169
N° 5 17757799..17758199 401  
complement(join(17757799..17758199,17758363..17758531,17758615..17758803,1775890 4..17759052,17759250..17759325))


exon

Literature and cross-references AlyPrx21
DNA ref. Phytozome 12:   scaffold_4 (17759325..17757799)
Protein sequence: AlyPrx21
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (299)
PWM (Da):   %s   36669.5 (33499.9) Transmb domain:   %s   i7-26o
PI (pH):   %s   7.45 (7.12) Peptide Signal:   %s   cut: 29 range:29-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANAKHFCLFGFFCLLLQLFSIFHIGNGELEMNYYRESCPKAEEIIRQQVETLYYKHGNTAVSWLRNLFHDCVVSCDASLLLETARGVESEQKSKRSFGMRNFKYVKIIKDALEKECPSTVSCADIVALSARDGIVMLKGPKIEMIKTGRRDSRGSYLGDVETLIPNHNDSLSSVISTFNSIGIDVEATVALLGAHSVGRVHCVNLVHRLYPTIDPTLDPSYALYLKKRCPSPTPDPNAVLYSRNDRETPMVVDNMYYKNIMAHKGLLVIDDELATDPRTAPFVAKMATDNGYFQEQFSRGVRLLSETNPLTGDQGEIRKDCRYVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 4 introns, extra 5' intron),
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATGCGAAGCACTTTTGTCTCTTCGGCTTCTTTTGTCTGTTATTACAGTTATTCTCCATCTTCCATATCGGTAAATACATTCTTCACTGATGCAATCATGTTATGCCATGTGTC
ACCATGCTTCCAATTATCATTTACCTATAGACTAGTAATGAATTTCTTTCACTAATACAATTTCCACCGTTAAATATCAACATTTTTTTAAAATGTTAGTATTCGCTAGTAAACACACAT
CTAAATAAAGTAAATATTCTATAAACATTGTAGGAAATGGGGAATTGGAGATGAACTATTACAGAGAGAGTTGTCCAAAAGCGGAAGAGATTATAAGACAACAAGTGGAGACGCTTTACT
ACAAACACGGCAACACAGCCGTATCTTGGCTCCGTAATCTCTTCCATGACTGTGTCGTCAAG
GTAATTAAATCTCTTTGATAGTTCTATAAATTCACCAAAATTAATACGACAAAACTAT
ATGTAGTATTAACGTTCATGTGTGTGTTTTCTTATTGTGTAGTCGTGTGATGCGTCGCTGCTTCTAGAGACAGCGAGAGGTGTGGAATCTGAGCAGAAATCGAAGAGGAGTTTCGGTATG
AGAAACTTTAAGTACGTTAAGATTATCAAAGACGCACTCGAGAAAGAGTGTCCTTCAACAGTTTCTTGCGCTGATATTGTCGCTCTCTCTGCTAGAGACGGTATTGTCATG
GTGCGTTTA
GGCAAATATTTACATGCATTTTAGTTGGGAATTTTTTTGTATTTGTGGTAATTAATATTTGGTGAAATTATTAGTTGAAAGGTCCAAAGATTGAGATGATAAAGACAGGAAGGAGAGATA
GCAGAGGGAGCTACTTGGGAGATGTTGAGACTCTAATCCCTAACCACAATGACTCTCTTTCCTCTGTTATATCCACCTTTAACTCCATTGGTATTGATGTCGAAGCCACTGTCGCTCTCT
TAG
GTATACCATCTTTTATTTAGTTATTGGGTTTGGTATTGATTCGGTTCGGAGATAGAGACGGAAGTATAAAAACTATAACATAGAAATTTTCTTAGAGAAATAAATTCTATTTTCTTA
ATAAGAATGATATTTGTAATTGATCAGTCAATATATACTACTGTAGGTGCTCACTCAGTGGGTAGGGTCCACTGCGTTAACCTAGTGCACCGGCTATACCCAACGATTGACCCGACCCTC
GACCCAAGTTACGCCCTTTACTTAAAAAAACGTTGCCCAAGTCCAACACCGGACCCGAACGCCGTCTTGTACTCCCGCAACGATCGTGAGACTCCGATGGTTGTGGACAACATGTATTAC
AAGAATATCATGGCACATAAGGGGCTTCTTGTCATTGATGATGAGCTAGCCACCGATCCAAGGACCGCACCGTTTGTGGCCAAGATGGCTACGGACAATGGTTACTTCCAGGAGCAGTTC
TCACGTGGCGTCAGGCTCTTGTCCGAGACCAACCCACTCACTGGAGACCAAGGGGAGATCAGGAAGGATTGCCGTTATGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATGCGAAGCACTTTTGTCTCTTCGGCTTCTTTTGTCTGTTATTACAGTTATTCTCCATCTTCCATATCGGAAATGGGGAATTGGAGATGAACTATTACAGAGAGAGTTGTCCA
AAAGCGGAAGAGATTATAAGACAACAAGTGGAGACGCTTTACTACAAACACGGCAACACAGCCGTATCTTGGCTCCGTAATCTCTTCCATGACTGTGTCGTCAAG
TCGTGTGATGCGTCG
CTGCTTCTAGAGACAGCGAGAGGTGTGGAATCTGAGCAGAAATCGAAGAGGAGTTTCGGTATGAGAAACTTTAAGTACGTTAAGATTATCAAAGACGCACTCGAGAAAGAGTGTCCTTCA
ACAGTTTCTTGCGCTGATATTGTCGCTCTCTCTGCTAGAGACGGTATTGTCATG
TTGAAAGGTCCAAAGATTGAGATGATAAAGACAGGAAGGAGAGATAGCAGAGGGAGCTACTTGGGA
GATGTTGAGACTCTAATCCCTAACCACAATGACTCTCTTTCCTCTGTTATATCCACCTTTAACTCCATTGGTATTGATGTCGAAGCCACTGTCGCTCTCTTAG
GTGCTCACTCAGTGGGT
AGGGTCCACTGCGTTAACCTAGTGCACCGGCTATACCCAACGATTGACCCGACCCTCGACCCAAGTTACGCCCTTTACTTAAAAAAACGTTGCCCAAGTCCAACACCGGACCCGAACGCC
GTCTTGTACTCCCGCAACGATCGTGAGACTCCGATGGTTGTGGACAACATGTATTACAAGAATATCATGGCACATAAGGGGCTTCTTGTCATTGATGATGAGCTAGCCACCGATCCAAGG
ACCGCACCGTTTGTGGCCAAGATGGCTACGGACAATGGTTACTTCCAGGAGCAGTTCTCACGTGGCGTCAGGCTCTTGTCCGAGACCAACCCACTCACTGGAGACCAAGGGGAGATCAGG
AAGGATTGCCGTTATGTGAACTAA

Retrieve as FASTA