Entry information : AlyPrx34-1
Entry ID 7512
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx34-1
Name AlyPrx34-1
Class Class III peroxidase    [Orthogroup: Prx035]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx34-1
start..stop
S start..stop
AtPrx34 686 0 1..353 1..353
AhalPrx22 684 0 1..353 1..353
BstrPrx03 666 0 1..353 1..353
BrPrx34-1Ab_other 663 0 7..353 3..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14173608..14173838 231 N° 2 14174520..14174711 192 N° 3 14175173..14175341 169 N° 4 14175430..14175899 470
join(14173608..14173838,14174520..14174711,14175173..14175341,14175430..14175899 )


exon

Literature and cross-references AlyPrx34-1
DNA ref. Phytozome 12:   scaffold_5 (14173608..14175899)
Protein sequence: AlyPrx34-1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353 (323)
PWM (Da):   %s   38660.47 (35421.9)  
PI (pH):   %s   6.97 (6.74) Peptide Signal:   %s   cut: 31 range:31-353
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLSSSSTSFTWTTIITLGCLLLHSSLSYAQLTPTFYDSSCPNVTNIVRETIVNELRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAFGNANSARGFPVIDRMKAAVERACPRTVSCADMLTIAAQQSVTLAGGPSWRVPLGRRDSLQAFLNLANANLPAPFFTLPELKASFKNVGLDRPSDLVALSGGHTFGKNQCQFILDRLYNFSNTGLPDPTLNTTYLQTLRGLCPLNGNRSALVDFDLRTPTVFDNKYYVNLKEQKGLIQSDQELFSSPNATDTIPLVRAYADGTQTFFNAFVEAMNRMGNITPTTGTQGQIRLNCRVVNSNTLLQDVVEIVDFVSSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns),
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTATCTTCGTCTTCTACATCGTTCACTTGGACAACCATAATCACATTGGGATGTCTTTTGCTTCATTCATCTTTGTCCTATGCTCAACTTACCCCTACCTTCTACGATAGTTCA
TGTCCTAACGTCACTAACATCGTACGAGAAACCATTGTAAATGAGTTAAGGTCGGACCCTCGTATCGCTGCGAGCATCCTTCGTCTTCACTTCCACGACTGCTTTGTTAAT
GTAAGATAT
TACTTTTCATATATCTATAGCGTTGCGGATTACTGTGGTTCATCTTTTAAATATTAATAAATCTGTGTAAAAGTAGAAAAAAAAAAGTGATAATAAATGTCTTTAGACTCTTAGTTAATG
ACTAAATTTTTGCACTAAAGCCTAAATTTCACGTAGTTCGATGTCATTTGTTGCTACTTTACGTTTTCTATATTGAAAATTAATACTACTCGTCGACAGTGATGTTACTGGTTAGTTATT
AATTTCTTACACTATGATGATGCCAAAACATTTATGCAATCGGCTTCACGAAAATGAAGTATCCGTGTTTGAATTGCATGGTGCCGTACCAAACACGATAGAAATTTAAGATCCATCAAT
CATTTATATTTTGTTGAGGGATATATATATATATATTAAAAAGATATTTTTCAAATCAATCAAAAATCATGATTATTAATTTCTATTATTCAATTCAATTTTGATTAGTTTCAATATTTT
AATGTGATTATGTATAAATATTCATCAATATACAAAATATTTTTGTTGAAAAGTGTTTTATTTTCTATTGAGTTCAAATGTTTCTGATCACTTTGTTTTCATTACATAGATATATAACCT
TCACTGGTTACTTGCTTCAGAAGAACAAATGATTTTAGTGATCAATGACAAAAAGTTTTTACTATGGTAAAGGGCTGTGACGCATCCATCTTGTTAGACAACACGACATCATTTCGAACA
GAGAAAGATGCCTTTGGAAACGCAAATTCGGCTCGAGGATTTCCTGTGATTGATAGAATGAAAGCCGCGGTGGAGAGGGCATGCCCAAGAACCGTTTCGTGCGCAGATATGCTCACCATT
GCAGCTCAACAATCTGTCACTTTG
GTATGCTCCATTTTTCTTTTATTCATTACAAACACTGTTTTCAGTTTTAATGTCAACTTTGAATAGCCGCTTTATCAAACATGCGAACCTAAGTTT
GAAAAGAAAAATAACTGGGATATTTTTAGTTGTTTGAGAACGTCACAATCTATATTTTAGTAACAACTTTTTAACTATATGACAAGTATTCAATGTTAATTGAGAAAAGCGCGTGGTCCC
GTCAAGAAAATTTGACAAAATTAGGTTTTTTATCACTAGTTTCGATATCATATTAACCCAAAAGAATACTTTTCAACATTTTCCCAAGAAATAGTGGAGATATAAAAAGTTACTTTTATG
TATATATATCTAATCAGTGAATTTATAATACATGACCGTCTTTTTCTTTTTACATATTAAAACTTCCGGATGATAAAAATAATCTCAAGAAATATTATCTTAATATAATGGTTATTATAC
TATAGGCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGAAGGAGAGACAGCTTACAAGCATTTCTAAATCTCGCTAATGCAAATCTCCCAGCTCCATTCTTCACACTTCCAGAGCTTAAAG
CCAGCTTCAAAAATGTTGGCCTCGATCGTCCTTCTGATCTTGTTGCTCTCTCCG
GTAATTAACAAAAGAAAATTAAACACCATTGATACAATATCAATTAGCGAGTTTATTACTAATCTA
ATTATGGTATTTGTTTTGTTAGGTGGTCACACATTTGGTAAAAATCAATGTCAGTTTATTCTGGACAGATTATACAATTTCAGCAACACAGGTTTACCCGACCCTACCCTCAATACTACT
TACCTCCAAACTCTTCGTGGACTATGCCCCCTTAATGGCAATCGAAGTGCCTTGGTCGATTTTGATCTGCGTACGCCTACAGTTTTCGACAACAAATACTACGTAAATCTCAAAGAGCAA
AAAGGTCTTATCCAGAGCGATCAAGAGTTGTTCTCTAGCCCCAATGCCACTGACACAATCCCCTTGGTGAGAGCATATGCTGATGGCACACAAACATTCTTCAATGCATTTGTGGAGGCG
ATGAATAGGATGGGAAACATTACACCTACTACAGGAACTCAAGGACAAATCAGGTTGAATTGTAGGGTGGTGAACTCCAACACTCTGCTCCAAGATGTGGTGGAGATCGTTGACTTTGTT
AGCTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTATCTTCGTCTTCTACATCGTTCACTTGGACAACCATAATCACATTGGGATGTCTTTTGCTTCATTCATCTTTGTCCTATGCTCAACTTACCCCTACCTTCTACGATAGTTCA
TGTCCTAACGTCACTAACATCGTACGAGAAACCATTGTAAATGAGTTAAGGTCGGACCCTCGTATCGCTGCGAGCATCCTTCGTCTTCACTTCCACGACTGCTTTGTTAAT
GGCTGTGAC
GCATCCATCTTGTTAGACAACACGACATCATTTCGAACAGAGAAAGATGCCTTTGGAAACGCAAATTCGGCTCGAGGATTTCCTGTGATTGATAGAATGAAAGCCGCGGTGGAGAGGGCA
TGCCCAAGAACCGTTTCGTGCGCAGATATGCTCACCATTGCAGCTCAACAATCTGTCACTTTG
GCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGAAGGAGAGACAGCTTACAAGCATTT
CTAAATCTCGCTAATGCAAATCTCCCAGCTCCATTCTTCACACTTCCAGAGCTTAAAGCCAGCTTCAAAAATGTTGGCCTCGATCGTCCTTCTGATCTTGTTGCTCTCTCCG
GTGGTCAC
ACATTTGGTAAAAATCAATGTCAGTTTATTCTGGACAGATTATACAATTTCAGCAACACAGGTTTACCCGACCCTACCCTCAATACTACTTACCTCCAAACTCTTCGTGGACTATGCCCC
CTTAATGGCAATCGAAGTGCCTTGGTCGATTTTGATCTGCGTACGCCTACAGTTTTCGACAACAAATACTACGTAAATCTCAAAGAGCAAAAAGGTCTTATCCAGAGCGATCAAGAGTTG
TTCTCTAGCCCCAATGCCACTGACACAATCCCCTTGGTGAGAGCATATGCTGATGGCACACAAACATTCTTCAATGCATTTGTGGAGGCGATGAATAGGATGGGAAACATTACACCTACT
ACAGGAACTCAAGGACAAATCAGGTTGAATTGTAGGGTGGTGAACTCCAACACTCTGCTCCAAGATGTGGTGGAGATCGTTGACTTTGTTAGCTCTATGTGA

Retrieve as FASTA