Entry information : AlyPrx18
Entry ID 7513
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx18
Name AlyPrx18
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx18
start..stop
S start..stop
AtPrx18 624 0 1..329 1..329
AhalPrx25 622 0 1..329 1..329
BstrPrx63 616 0 1..329 1..332
CrubPrx55 604 0 1..329 1..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3439834..3440061 228 N° 2 3439565..3439744 180 N° 3 3439244..3439409 166 N° 4 3438746..3439161 416
complement(join(3438746..3439161,3439244..3439409,3439565..3439744,3439834..3440 061))


exon

Literature and cross-references AlyPrx18
DNA ref. Phytozome 12:   scaffold_4 (3440061..3438746)
Protein sequence: AlyPrx18
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (300)
PWM (Da):   %s   35464.82 (32327.1)  
PI (pH):   %s   4.75 (4.60) Peptide Signal:   %s   cut: 30 range:30-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALQFSSCRPKSTFFSSLLLLLLLSPSVAELSFNFYAGSCPGAELIVRNTVRSASSSDPSVLGKLLRLIFHDCFVKGCDGSVLIRGNGTERSDPGNASLGGFTVIESIKNVLEIFCPGTVSCADILVLAARDAVEALGGPVVPIPTGRRDGTVSMAENVRPNIIDTDFTVDKMINIFSSKGLSVQDLVVLSGAHTIGAAHCNTFNSRFKLDPKGNLELIDASLDNSYAQTLVNKCSSSLDPTTTVVDNDPETSSTFDNQYYKNLLAHKGLFQTDSALMEDDRTRKIVEILANDEESFFDRWTESFLKMSLMGVRVGEEGEIRRSCSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns),
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGCAGTTTTCTTCATGCAGACCAAAATCCACCTTCTTCTCCTCTCTTCTTCTACTTCTGCTTCTTTCTCCCTCAGTAGCTGAGCTCTCTTTCAACTTCTACGCCGGTTCTTGT
CCCGGAGCTGAGTTAATCGTCCGAAACACCGTTAGATCTGCTTCTTCCTCTGATCCATCAGTCCTTGGGAAGCTCCTACGTCTCATCTTCCATGATTGCTTCGTCAAG
GTACATTACATT
CTTCCAAGACTGTCTCTTTCTTGCATAACAAGGCATTTACAATGAAATGAGATTTGTTGTTGTCATTGCTGTCTTAGGGTTGTGATGGCTCGGTGTTGATTCGAGGGAACGGTACAGAGC
GAAGCGACCCTGGGAATGCGTCTCTAGGAGGATTCACTGTTATAGAAAGCATCAAAAATGTCCTCGAAATCTTTTGTCCCGGCACAGTGTCTTGCGCTGATATACTTGTTCTTGCTGCTA
GAGATGCAGTAGAAGCT
GTAAGAATTTCATCAAAATTCACATACATAAGAAATGTATATATATCTCAATATTTGAAACCAGACTTTTGCATTAAAAACTCTGTTTCTTTCTTTCTTTTTT
TGGTTTTTAAAAACTCTGTTTCTTGTTGTTGTGTATACTATTTTCCGGACAGCTAGGAGGACCGGTAGTTCCGATACCGACAGGGAGAAGAGACGGGACAGTCTCAATGGCAGAAAATGT
CAGACCAAACATCATCGATACTGACTTCACAGTTGATAAGATGATCAATATCTTTTCCTCTAAAGGCTTATCTGTTCAAGATCTAGTCGTCCTCTCTG
GTACGTTATGTTTCTTGATATT
CAATAAGGAGAGATCTTTCTCTAAAACAAACCTGGAAATTTCGATCTATTATGGTCTCAGGAGCACACACTATTGGAGCTGCGCATTGCAACACATTCAACAGCAGGTTTAAGCTTGATC
CAAAAGGCAACTTAGAGCTAATAGACGCGTCTCTCGATAACTCCTATGCGCAAACACTTGTAAACAAGTGTTCATCGTCATTAGATCCAACGACCACGGTCGTTGACAACGATCCAGAGA
CATCTTCAACGTTCGATAATCAGTACTACAAGAATCTGTTGGCGCACAAGGGTTTGTTTCAGACGGATTCAGCTCTCATGGAAGATGATCGAACGAGGAAGATTGTTGAGATTCTTGCGA
ATGATGAGGAGAGTTTCTTCGATAGATGGACTGAGTCTTTTTTGAAGATGAGTTTGATGGGTGTGAGAGTTGGTGAGGAAGGTGAGATTAGACGTTCTTGTTCTGCTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGCAGTTTTCTTCATGCAGACCAAAATCCACCTTCTTCTCCTCTCTTCTTCTACTTCTGCTTCTTTCTCCCTCAGTAGCTGAGCTCTCTTTCAACTTCTACGCCGGTTCTTGT
CCCGGAGCTGAGTTAATCGTCCGAAACACCGTTAGATCTGCTTCTTCCTCTGATCCATCAGTCCTTGGGAAGCTCCTACGTCTCATCTTCCATGATTGCTTCGTCAAG
GGTTGTGATGGC
TCGGTGTTGATTCGAGGGAACGGTACAGAGCGAAGCGACCCTGGGAATGCGTCTCTAGGAGGATTCACTGTTATAGAAAGCATCAAAAATGTCCTCGAAATCTTTTGTCCCGGCACAGTG
TCTTGCGCTGATATACTTGTTCTTGCTGCTAGAGATGCAGTAGAAGCT
CTAGGAGGACCGGTAGTTCCGATACCGACAGGGAGAAGAGACGGGACAGTCTCAATGGCAGAAAATGTCAGA
CCAAACATCATCGATACTGACTTCACAGTTGATAAGATGATCAATATCTTTTCCTCTAAAGGCTTATCTGTTCAAGATCTAGTCGTCCTCTCTG
GAGCACACACTATTGGAGCTGCGCAT
TGCAACACATTCAACAGCAGGTTTAAGCTTGATCCAAAAGGCAACTTAGAGCTAATAGACGCGTCTCTCGATAACTCCTATGCGCAAACACTTGTAAACAAGTGTTCATCGTCATTAGAT
CCAACGACCACGGTCGTTGACAACGATCCAGAGACATCTTCAACGTTCGATAATCAGTACTACAAGAATCTGTTGGCGCACAAGGGTTTGTTTCAGACGGATTCAGCTCTCATGGAAGAT
GATCGAACGAGGAAGATTGTTGAGATTCTTGCGAATGATGAGGAGAGTTTCTTCGATAGATGGACTGAGTCTTTTTTGAAGATGAGTTTGATGGGTGTGAGAGTTGGTGAGGAAGGTGAG
ATTAGACGTTCTTGTTCTGCTGTTAATTAA

Retrieve as FASTA