Entry information : AlyAPx06
Entry ID 7515
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyAPx06
Name AlyAPx06
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyAPx06
start..stop
S start..stop
AhalAPx08 805 0 1..429 1..424
AtAPx06 790 0 1..429 1..426
CagraAPx06 750 0 1..429 1..430
CrubAPx06 749 0 1..429 1..430
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17662708..17662899 192 N° 2 17662975..17663109 135 N° 3 17663245..17663365 121 N° 4 17663449..17663549 101
N° 5 17663635..17663722 88 N° 6 17663827..17663894 68 N° 7 17663969..17664055 87 N° 8 17664140..17664214 75
N° 9 17664297..17664374 78 N° 10 17664475..17664579 105 N° 11 17664712..17664771 60 N° 12 17664871..17665050 180
join(17662708..17662899,17662975..17663109,17663245..17663365,17663449..17663549 ,17663635..17663722,17663827..17663894,17663969..17664055,17664140..17664214,176 64297..17664374,17664475..17664579,17664712..17664771,17664871..17665050)


exon

Literature and cross-references AlyAPx06
DNA ref. Phytozome 11:   scaffold_2 (17662708..17665050)
Protein sequence: AlyAPx06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   429
PWM (Da):   %s   46394.75 Transmb domain:   %s   o400-422i
PI (pH):   %s   7.92
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVSLSAASHLLCSSTRVSLFPAVTSSSSPVVALSSSASPHSLSSLRSVASSSLFPCTTSFVLQRKHPINGTSTRMVSPKCAASDAAQLRSAKEDIKVLLRTKFCHPILVRLGWHDAGTYNKNIEEWPQRGGANGSLRFEAELKHAANAGLLNALKLIQPIKDKYPNISYADLFQLASATAVEAGGPEIPMKYGRVDVVAPEQCPEEGRLPDAGPPSPADHLRDVFYRMGLDDEIVALSGAHTLGRARPDRSGWGKPETKYTKTGPGEAGGQSWTVKWLKFDNSYFKDIKEKRDEDLLVLPTDAVLFEDPSFKNYAEKYAEDPAAFFKDYAEAHAKLSNLGAKFDPPEGIIIDNAPEKFVAAKYSTGKKELSDSMKKKIRAEYEAIGGSPDKPLPTNYFLNIIIAIGVLVLLSTLFGGNNNSDFSGF*

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 2, 11 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTTTCTCTCTCCGCCGCCTCTCACTTACTCTGTTCCTCCACCAGAGTATCTCTTTTCCCCGCCGTCACCTCCTCCTCGTCCCCTGTCGTTGCTCTTTCTTCCTCTGCATCGCCA
CATTCTCTGTCTTCTCTTCGAAGCGTCGCGTCTTCTTCTCTGTTTCCTTGCACCACCTCCTTCGTTCTTCAG
GTATTCTTCCTTCAGTTGCGAGATTCATACTTTTGTAAATTTCTCTCT
GAACATAACATTTTCTGTTGATTTTAGAGAAAACATCCGATCAATGGGACGAGCACGAGGATGGTTTCACCAAAATGTGCGGCTTCTGATGCAGCTCAATTGAGAAGCGCTAAAGAAGAT
ATCAAAGTTCTTCTCCGGACTAAGTTTTGTCATCCCATTTTG
GTAAAGTATCTTTCTCTTCTTTTGCAGCTGGATCACGATTCTACGGCATTGGTACTACAGATATTGGAGGAAGAGAAT
TGAATTTTGTGAGTCATGTTGCTTTGTGTTTGACAAGGGTAACATGTTTCAATGCAGGTTAGATTGGGATGGCACGATGCTGGTACATATAACAAGAACATTGAGGAGTGGCCACAGAGA
GGTGGAGCTAATGGAAGTCTTAGGTTTGAGGCTGAGCTTAAGCATGCTGCAAATGCCG
GTACTGTTTCCAACACAATTCACCTGCGTTGTGGGCTTGAGACTTTGTTTTTGGTCTTTATA
TTCTACTTTTGACTTTTCCAGGTCTGCTTAATGCTTTAAAGCTTATTCAGCCTATCAAAGACAAGTATCCTAACATCTCTTATGCGGACTTATTCCAGTTAGCTAGTGCCACTGCAGTAG
AG
GTTCTGAAATCCTGATGAAATTATGTTGGGCTTGGCTTAGCAGGAAACTACGTAGGTCTAAAAACTTTACTGCTTTTAACTTCAGGAGGCTGGTGGTCCTGAAATCCCGATGAAATAT
GGGAGAGTTGATGTCGTAGCACCTGAACAGTGTCCAGAAGAAGGAAGACTCCCTG
GTTAACTAATCCTTTCCATTGTCTGTTTCATGGCTTCAATGAGTTTGTTTCAGATTCTATTATGG
ACTAATTAAGTTAACGAGGTCATATGTGCTGTGTTTTAGATGCTGGACCTCCCTCACCAGCTGATCATTTGAGAGATGTATTTTACAGAATGGGACTAGATGACAAGGTGGTTTTGATTC
TGTTCCATGTCAAACATGAATATTCTCAATTTCTGACAGTCGAGGTTGTTTTGTCAAGCAGGAAATAGTTGCCTTGTCTGGTGCACATACCTTAGGAAGAGCCAGACCAGACCGTAGCGG
TTGGGGAAAACCTGAGACAAAGTACACG
GTATAATAAACGACAAAATGAACTCCCTTATGTTGTTGTTGCAATGATAGTGTAGAGATGTTATGGAAACGTTCAACATGGCAGAAAACTGG
ACCAGGAGAAGCAGGAGGACAGTCATGGACAGTGAAATGGCTTAAGTTCGACAATTCTTACTTCAAG
GTCTAACTCTCTATCTTTCTTAGTAACTTGGTTTGAGACTGAAGAAGAGTTTT
CTGAATCATTGACTTCTATGACTTTGCAGGATATCAAAGAAAAGAGGGATGAAGATCTTCTGGTGTTACCCACTGATGCTGTACTATTCGAAGATCCTTCATTCAAGGTATAAAGTATAA
ACAACAGTGATTGCTAGAAAGATGCCTCAGAAGTAGTAGTTCAGTGTTAATTAAGAGGAAATGTTTTCAAAAAAATCTGTTTTACAGAACTATGCGGAGAAGTATGCTGAAGATCCGGCT
GCATTTTTCAAGGATTACGCTGAAGCTCATGCCAAGCTCAGCAATCTCGGCGCAAAATTTGATCCTCCCGAG
GTACAAGGAAAGAGAGAAAATCTAATCTCTTCGCACTTGTGTTAACCT
TTATGAACCATTCGTTAAAATCCAGTTCAGTGACTTAAACCATATAGTCTAAAACAGCTAATGTGTTACTACAATACTAAACAGGGCATTATCATTGACAACGCTCCAGAGAAGTTTGTA
GCTGCGAAGTATTCCACGGGAAAG
GTTTGTCCTTTCTAAACAAAAATGTGTTTGTGTAGCTTATTCTAATATACATGTTGAGGAAACGAGTCTTGTTTTTAATTTTCCAGTAATATTTTG
CAGAAGGAGCTTTCGGATTCGATGAAAAAGAAGATAAGAGCAGAGTATGAAGCAATTGGAGGAAGCCCAGATAAGCCATTACCCACAAATTACTTCCTTAACATCATAATTGCCATTGGC
GTTTTGGTCCTCTTGTCCACTCTCTTTGGTGGTAATAACAATTCCGATTTCTCTGGTTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTTTCTCTCTCCGCCGCCTCTCACTTACTCTGTTCCTCCACCAGAGTATCTCTTTTCCCCGCCGTCACCTCCTCCTCGTCCCCTGTCGTTGCTCTTTCTTCCTCTGCATCGCCA
CATTCTCTGTCTTCTCTTCGAAGCGTCGCGTCTTCTTCTCTGTTTCCTTGCACCACCTCCTTCGTTCTTCAG
AGAAAACATCCGATCAATGGGACGAGCACGAGGATGGTTTCACCAAAA
TGTGCGGCTTCTGATGCAGCTCAATTGAGAAGCGCTAAAGAAGATATCAAAGTTCTTCTCCGGACTAAGTTTTGTCATCCCATTTTG
GTTAGATTGGGATGGCACGATGCTGGTACATAT
AACAAGAACATTGAGGAGTGGCCACAGAGAGGTGGAGCTAATGGAAGTCTTAGGTTTGAGGCTGAGCTTAAGCATGCTGCAAATGCCG
GTCTGCTTAATGCTTTAAAGCTTATTCAGCCT
ATCAAAGACAAGTATCCTAACATCTCTTATGCGGACTTATTCCAGTTAGCTAGTGCCACTGCAGTAGAG
GAGGCTGGTGGTCCTGAAATCCCGATGAAATATGGGAGAGTTGATGTCGTA
GCACCTGAACAGTGTCCAGAAGAAGGAAGACTCCCTG
ATGCTGGACCTCCCTCACCAGCTGATCATTTGAGAGATGTATTTTACAGAATGGGACTAGATGACAAGGAAATAGTTGCCTTG
TCTGGTGCACATACCTTAGGAAGAGCCAGACCAGACCGTAGCGGTTGGGGAAAACCTGAGACAAAGTACACG
AAAACTGGACCAGGAGAAGCAGGAGGACAGTCATGGACAGTGAAATGG
CTTAAGTTCGACAATTCTTACTTCAAG
GATATCAAAGAAAAGAGGGATGAAGATCTTCTGGTGTTACCCACTGATGCTGTACTATTCGAAGATCCTTCATTCAAGAACTATGCGGAGAAG
TATGCTGAAGATCCGGCTGCATTTTTCAAGGATTACGCTGAAGCTCATGCCAAGCTCAGCAATCTCGGCGCAAAATTTGATCCTCCCGAG
GGCATTATCATTGACAACGCTCCAGAGAAG
TTTGTAGCTGCGAAGTATTCCACGGGAAAG
AAGGAGCTTTCGGATTCGATGAAAAAGAAGATAAGAGCAGAGTATGAAGCAATTGGAGGAAGCCCAGATAAGCCATTACCCACAAATTAC
TTCCTTAACATCATAATTGCCATTGGCGTTTTGGTCCTCTTGTCCACTCTCTTTGGTGGTAATAACAATTCCGATTTCTCTGGTTTCTAA

Retrieve as FASTA