Entry information : AlyAPx02
Entry ID 7517
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyAPx02
Name AlyAPx02
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyAPx02
start..stop
S start..stop
AhalAPx07 503 0 1..251 1..251
AtAPx02 496 0 1..251 1..251
CagraAPx02 495 0 1..251 1..251
BstrAPx02 491 3e-179 1..251 1..251
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3816763..3816884 122 N° 2 3817011..3817185 175 N° 3 3817490..3817555 66 N° 4 3817724..3817772 49
N° 5 3817861..3817943 83 N° 6 3818021..3818100 80 N° 7 3818192..3818294 103 N° 8 3818384..3818442 59
N° 9 3818592..3818610 19  
join(3816763..3816884,3817011..3817185,3817490..3817555,3817724..3817772,3817861 ..3817943,3818021..3818100,3818192..3818294,3818384..3818442,3818592..3818610)


exon

Literature and cross-references AlyAPx02
DNA ref. Phytozome 12:   scaffold_3 (3816763..3818610)
Protein sequence: AlyAPx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   251
PWM (Da):   %s   28032.55  
PI (pH):   %s   6.43
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVNKSYPEVKEEYKKAVQRCKRKLRGLIAEKHCAPIVLRLAWHSAGTFDVKTKTGGPFGTIRHPQELAHEANNGLDIAIRLLEPIKELFPILSYADFYLAGVVAVEITGGPEIPFHPGRLDKVEPPPEGRLPQATKGVDHLRDVFSRMGLNDKDIVALSGGHTGRCHKERSGFEGAWTQNPLIFDNSYFKEILSGEKEGLLQLPSDKALLDDPLFRPFVERYADEDAFFEDYKEAHLKLSELGFADKE

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 3, 8 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAATAAGAGTTACCCGGAAGTGAAAGAAGAGTACAAGAAAGCTGTTCAGAGATGCAAGAGGAAGCTCCGTGGTCTTATCGCCGAGAAGCACTGTGCTCCTATCGTTCTCCGTCTT
GC
GTAAGATCCTCTCTCTGGTTCCAGTCTCTTCTGTTTCTGAATAGTAGTTCCTTTTCGTTTGCTTATGAGTGTTGATGCGTTTGTGAGTTGTCTCTGAGAGTTTCTTTTTGCTGGGAAA
ATTTGAAGATGGCACTCGGCTGGGACATTTGACGTGAAGACGAAGACAGGAGGACCGTTTGGAACGATAAGGCATCCCCAAGAGCTAGCCCATGAGGCCAACAATGGTCTTGATATAGCA
ATTAGGCTTCTTGAGCCGATCAAGGAGCTGTTCCCCATTCTGTCTTATGCTGATTTCTACCAG
GTAAAGTTTCAACATTGTGCTGAGTTTTTTAGCTGTAATACTGAAGCAAGGGATGCA
TCAAACTGTAGTAACTACTGGATTGAGGTAGAACCATAGACTCAAGGGTTTAGGGATGCCTGATCAATGATTGTAACTTCCAAATGTAGTAATTACGAGCTTGAAGTGATTTTGTTGGTA
ATAACCGCTAAGTTATGACCTAAAAAGGTTCAGCTGTCTGCTATTGGCCCTCTGGTTTTTGAACTACATTCACACAACTGAATCTAAAAGCTTACCTTGTATTTCCCATATTTTTTGGTT
ACTGTAGCTAGCTGGAGTTGTTGCTGTTGAGATCACTGGAGGACCCGAGATTCCATTCCATCCTGGTAGACTGGTGAGTCAATATTCAAATTCTCAGTTTTCTGGCTACCAATTCTTTGC
TTCATCTCTTCGATTCGCAATTTCTTCGATTTAAATCACAACTCACTGATGATGGTCTGATACAGACACCACTGCTAAGTTTTGTTCATGTGATTAACTTAAACCAAACTTCATCTTTCA
GGACAAAGTTGAGCCACCTCCTGAAGGTCGTCTGCCTCAGGCCACCAAAGGTAAAGCAGATCTTAGAAAATGCATTTAGTATTGAATTCGGGTAACAGATATAGATACATGTTCATAATC
TGTTTTATTGTCATCCAGGCGTGGATCATCTAAGAGATGTGTTTAGTCGGATGGGACTCAATGACAAAGATATTGTTGCATTGTCTGGTGGACACACCTTGGTATGTATGCTGCATCCAA
AAACAAAGACTTATGAGCTTTTCCCCAGTTTTGGCTCATACCATTCATATACTTTCAGGGTCGGTGCCACAAGGAGCGCTCAGGATTCGAGGGAGCATGGACACAAAACCCGCTCATTTT
CGACAACTCCTATTTCAA
GTAAGATCAGATTCTCTGCTTCTGCTTGCTCATACTTGAATTGGACCAGAGCTGAATCAGAAGCTCTTGAATCTTGATGGTTGTTAAACAGAGAGATACTAA
GCGGAGAGAAAGAAGGACTTCTTCAATTACCAAGCGACAAGGCTCTTCTCGATGATCCTCTCTTTCGTCCCTTTGTTGAGAGATATGCGGCA
GTAAGTTATTCAACTCATCATTTCATGA
TTCTCATTCGTCATACATATATGTCAATAGGATATATCACAGACTCGATTGTTACTCTCAGGATGAGGATGCCTTCTTCGAAGACTATAAAGAAGCTCATCTGAAGTTGTCAGAACTCGG
GTAAATAACACATAAAACAATCTCTCTCTCAACATTTTGTTTTAACTTTTTTCTTATTGTCCTACTCCTAGTCGTAAACTTCGATTGTTCCTCAGAAACTTTTCAATTACAAACAGATTT
TGTCTAAACCAGATATAATCACTAAACAGGTTTGCTGACAAGGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAATAAGAGTTACCCGGAAGTGAAAGAAGAGTACAAGAAAGCTGTTCAGAGATGCAAGAGGAAGCTCCGTGGTCTTATCGCCGAGAAGCACTGTGCTCCTATCGTTCTCCGTCTT
GC
ATGGCACTCGGCTGGGACATTTGACGTGAAGACGAAGACAGGAGGACCGTTTGGAACGATAAGGCATCCCCAAGAGCTAGCCCATGAGGCCAACAATGGTCTTGATATAGCAATTAGG
CTTCTTGAGCCGATCAAGGAGCTGTTCCCCATTCTGTCTTATGCTGATTTCTACCAG
CTAGCTGGAGTTGTTGCTGTTGAGATCACTGGAGGACCCGAGATTCCATTCCATCCTGGTAGA
CTG
GACAAAGTTGAGCCACCTCCTGAAGGTCGTCTGCCTCAGGCCACCAAAGGCGTGGATCATCTAAGAGATGTGTTTAGTCGGATGGGACTCAATGACAAAGATATTGTTGCATTGTCT
GGTGGACACACCTTG
GGTCGGTGCCACAAGGAGCGCTCAGGATTCGAGGGAGCATGGACACAAAACCCGCTCATTTTCGACAACTCCTATTTCAAAGAGATACTAAGCGGAGAGAAAGAA
GGACTTCTTCAATTACCAAGCGACAAGGCTCTTCTCGATGATCCTCTCTTTCGTCCCTTTGTTGAGAGATATGCGGCA
GATGAGGATGCCTTCTTCGAAGACTATAAAGAAGCTCATCTG
AAGTTGTCAGAACTCGG
GTTTGCTGACAAGGAGTAA

Retrieve as FASTA