Entry information : AlyAPx05
Entry ID 7525
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-12 (Christophe Dunand)
Peroxidase information: AlyAPx05
Name AlyAPx05
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyAPx05
start..stop
S start..stop
BstrAPx05 610 0 1..370 1..367
CagraAPx05 610 0 1..370 1..373
BnAPx04-1Aa_other 602 0 1..370 1..354
CrubAPx05 601 0 1..370 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18534569..18534793 225 N° 2 18534868..18535014 147 N° 3 18535095..18535215 121 N° 4 18535299..18535399 101
N° 5 18535471..18535558 88 N° 6 18535662..18535729 68 N° 7 18535814..18535900 87 N° 8 18536007..18536081 75
N° 9 18536176..18536253 78 N° 10 18536339..18536443 105 N° 11 18536688..18536703 16  
join(18534569..18534793,18534868..18535014,18535095..18535215,18535299..18535399 ,18535471..18535558,18535662..18535729,18535814..18535900,18536007..18536081,185 36176..18536253,18536339..18536443,18536688..18536703)


exon

Literature and cross-references AlyAPx05
DNA ref. Phytozome 11:   scaffold_6 (18534569..18536703)
Protein sequence: AlyAPx05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   370
PWM (Da):   %s   40459.62  
PI (pH):   %s   8.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTERVFLTLNGTLLSRPKTTATTMSSSLRSTTAASRLLRSSSSTRSTLTLSAFTSLSFARSLVSSPLLSSSPLSQKKYRVSSVNRSFNSTAATTKCSASDPDQLKNAREDIKELLNTKFCHPILVRLGWHDAGTYNKNIKEWPQRGGANGSLRFEIELKHAANAGLVNALNLIKDIKEKYSGITYADLFQLASATAIEAGGPKIPMKYGRVDASGPEDCPEEGRLPDAGPPSPANHLREVFYRMGLDDDIVALSGAHTLGRSRPERSGWGKPETKYTKEGPGAPGGQSWTPEWLKFDNSYFKEIKEKRDEDLLVLPTDAAIFEDSSFKVYAEKYAADQDAFFKDYAVAHAKLSNLGAKFDPPEGYRX

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGAGCGTGTGTTTCTCACACTCAACGGAACCCTCCTATCTCGTCCCAAAACCACCGCAACAACAATGTCTTCTTCTCTCCGTTCTACCACCGCCGCTTCTCGTCTCCTCCGCTCC
TCCTCCTCCACCAGATCCACTCTCACTCTCTCCGCTTTCACTTCTCTCTCCTTCGCCAGATCTCTCGTCTCTTCTCCACTTCTCTCTTCTTCACCCCTTTCTCAG
GTATATATATCCTTC
TAAAGCCTGATTTTCGAAATAATCCGATCTGATTTTTGATTCTTCTGTTGGATTTCCAGAAGAAATATCGAGTTTCGTCGGTGAATCGGAGCTTCAACTCCACCGCCGCAACTACTAAAT
GTTCAGCTTCAGATCCTGATCAGTTAAAAAATGCTAGAGAAGATATCAAAGAGCTTCTCAACACCAAATTCTGCCATCCAATTTTG
GTTCGTTTGATTCCACTAATCACTTCTCTGATTC
GTTTTATCGGTTTTTTGATATTATGTTGCGTTGTGTTGAATCATAGGTTCGATTAGGTTGGCATGATGCTGGTACATACAATAAGAACATTAAGGAATGGCCACAGAGAGGTGGAGCTAA
TGGAAGTTTGAGATTTGAGATTGAGCTTAAGCATGCTGCGAATGCTG
GTATAATATCACTTTATACGAATACGAATTAACGTCGTTTACTTGTGTTTGTTTCTATAAGCTTTGTTTGTTG
TGTGGTTTAGGTCTTGTGAATGCTTTAAACTTGATTAAGGATATCAAAGAGAAGTACTCTGGGATCACTTATGCTGATTTATTCCAATTGGCTAGTGCTACTGCTATAGAGGTGAGGTTG
ATGATTCTTAACCTAGTTTTTACTGGTTATGAAAAGATTTACTAAAGTTTTGGTAGTTTTAGGAAGCTGGAGGACCTAAAATACCGATGAAATATGGAAGAGTTGATGCCTCTGGTCCTG
AGGATTGTCCTGAAGAAGGAAGGCTCCCTG
GTAAAGTTTCTTCATTTACTGGTGTTTTCGGGCGTTCTTTGGTTATATTATTTGGGGGTATTAAAGTTGTACTGATTACAAATATCGCAT
GTTTGTTCTATAGATGCTGGTCCTCCTTCACCTGCTAATCATCTCAGAGAAGTTTTTTACAGAATGGGACTAGACGACAAGGTGATTGCGGTCGTAATTTTATCATAGTTATGGAAGATC
AGTGAGTTAATTATCCATATTGATTTTTTTTTTTTGTAAATGCAGGACATAGTTGCGTTGTCTGGGGCTCACACGTTAGGAAGATCTAGGCCAGAACGTAGTGGTTGGGGGAAGCCAGAG
ACGAAATACACG
GTATTATCCAGTTCTATTACGTATTGTCATGTTTGGGATTGCAGAACGTCAATGGAATAGAACATTTCGAATGTTAAGTTCTTAATGTGTTTTTTTCGCATTATAGAA
AGAGGGACCAGGCGCACCAGGAGGACAGTCATGGACACCAGAGTGGCTGAAGTTTGACAATTCTTACTTCAAG
GTTGCATTTTCAGAAGATAACTTTTACTTTACACTTTGTAATAATAG
TCTTCATTTTTCGATTTTGATGTCTATTAATATAATTATGATAACAGGAAATCAAGGAAAAGAGAGATGAAGATCTCCTTGTCCTACCCACTGATGCTGCCATCTTTGAAGATTCTTCTT
TCAAG
GTAACAAACCGAGGTTGAAACATATCAATTCGAAGAAACTTTCTGAGTCTTTGCCTTTAAAACTGAAACTGCATTGCAATTGCAGGTCTATGCTGAGAAGTATGCTGCTGATCAG
GATGCATTCTTCAAGGATTACGCTGTAGCCCATGCGAAGCTCAGCAATCTTGGAGCAAAATTTGACCCTCCTGAG
GTTAGCATTCTTTAGATTTCTGTCATGTGAATAGCATCAAAACCA
TTATCACTCTTGACCTTATCATCTTTAACCGAAAACGACCTTGAAATCAATCTTTTGGTCTACATAGAGAATTTACAAATTTGGCGAATCTAGAGCTGTGGAAATTAGATATCATCTTTT
TGACATTGGATGAGTCTCCACTCCATTGATGAATAAATTTGCAGAGGCTTAAGAACTGATTATCTGAATCTTTTGTGTAGGGTATCGTTATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGAGCGTGTGTTTCTCACACTCAACGGAACCCTCCTATCTCGTCCCAAAACCACCGCAACAACAATGTCTTCTTCTCTCCGTTCTACCACCGCCGCTTCTCGTCTCCTCCGCTCC
TCCTCCTCCACCAGATCCACTCTCACTCTCTCCGCTTTCACTTCTCTCTCCTTCGCCAGATCTCTCGTCTCTTCTCCACTTCTCTCTTCTTCACCCCTTTCTCAG
AAGAAATATCGAGTT
TCGTCGGTGAATCGGAGCTTCAACTCCACCGCCGCAACTACTAAATGTTCAGCTTCAGATCCTGATCAGTTAAAAAATGCTAGAGAAGATATCAAAGAGCTTCTCAACACCAAATTCTGC
CATCCAATTTTG
GTTCGATTAGGTTGGCATGATGCTGGTACATACAATAAGAACATTAAGGAATGGCCACAGAGAGGTGGAGCTAATGGAAGTTTGAGATTTGAGATTGAGCTTAAGCAT
GCTGCGAATGCTG
GTCTTGTGAATGCTTTAAACTTGATTAAGGATATCAAAGAGAAGTACTCTGGGATCACTTATGCTGATTTATTCCAATTGGCTAGTGCTACTGCTATAGAGGAAGCT
GGAGGACCTAAAATACCGATGAAATATGGAAGAGTTGATGCCTCTGGTCCTGAGGATTGTCCTGAAGAAGGAAGGCTCCCTG
ATGCTGGTCCTCCTTCACCTGCTAATCATCTCAGAGAA
GTTTTTTACAGAATGGGACTAGACGACAAG
GACATAGTTGCGTTGTCTGGGGCTCACACGTTAGGAAGATCTAGGCCAGAACGTAGTGGTTGGGGGAAGCCAGAGACGAAATACACGAAA
GAGGGACCAGGCGCACCAGGAGGACAGTCATGGACACCAGAGTGGCTGAAGTTTGACAATTCTTACTTCAAG
GAAATCAAGGAAAAGAGAGATGAAGATCTCCTTGTCCTACCCACTGAT
GCTGCCATCTTTGAAGATTCTTCTTTCAAG
GTCTATGCTGAGAAGTATGCTGCTGATCAGGATGCATTCTTCAAGGATTACGCTGTAGCCCATGCGAAGCTCAGCAATCTTGGAGCAAAA
TTTGACCCTCCTGAG
GGGTATCGTTATCTAA

Retrieve as FASTA