Entry information : AlyPrx71
Entry ID 7527
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx71
Name AlyPrx71
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx71
start..stop
S start..stop
AhalPrx30 657 0 1..328 1..328
AtPrx71 647 0 1..328 1..328
CagraPrx67 640 0 1..328 1..328
CrubPrx67 639 0 1..328 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21311918..21312337 420 N° 2 21311673..21311835 163 N° 3 21310962..21311365 404  
complement(join(21310962..21311365,21311673..21311835,21311918..21312337))


exon

Literature and cross-references AlyPrx71
DNA ref. Phytozome 12:   scaffold_8 (21312337..21310962)
Protein sequence: AlyPrx71
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (305)
PWM (Da):   %s   34812.66 (32283.3) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.43 (8.41) Peptide Signal:   %s   cut: 24 range:24-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGLVRSLCLFITFLSCLIILVHGQATGRPGPVSGTRIGFYLTTCPRAETIVRNAVNAGFSSDPRIAPGILRMHFHDCFVQGCDGSILISGANTERTAGPNLNLRGFEVIDNAKTQLEAACPGVVSCADILALAARDTVILTQGTGWQVPTGRRDGRVSLASNANNLPGPRDSVAVQQQKFSALGLNTRDLVVLAGGHTIGTAGCGVFRNRLFNTTGQPADPTIDPTFLSQLQTQCPQNGDASVRVDLDTGSGTTWDTSYYNNLSRGRGVLQSDQVLWTDPATRPIVQQLMAPRSTFNVEFARSMVRMSNIGVVTGANGEIRRVCSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, introns 2 and 3).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTGGTTAGATCATTGTGCTTATTCATAACCTTCCTTAGTTGTCTCATCATCTTGGTTCATGGCCAAGCCACCGGAAGGCCGGGTCCTGTTTCCGGCACAAGGATTGGGTTTTAC
TTGACCACGTGTCCTAGAGCTGAAACCATTGTCCGAAACGCCGTGAATGCTGGCTTCAGTTCTGACCCCAGAATCGCACCCGGAATACTGAGGATGCATTTCCACGACTGTTTTGTCCAA
GGTTGTGACGGTTCGATCCTTATATCGGGAGCTAACACCGAGAGAACCGCCGGTCCGAACCTCAATCTCCGAGGGTTTGAAGTCATCGACAACGCCAAAACGCAGCTCGAAGCCGCGTGT
CCAGGAGTTGTCTCGTGTGCTGATATTTTAGCCTTAGCCGCTCGTGACACAGTCATTCTC
GTAAGCCTTAATTATTTATAAACGTTATACGCAAATGCATTATCATTAATTTTCTATGTA
AATAACGTTATTGTGCATGCAGACGCAAGGAACAGGATGGCAAGTACCAACGGGACGTAGAGATGGCCGAGTTTCTTTGGCTTCGAATGCTAACAATCTCCCCGGTCCACGTGATTCCGT
TGCCGTACAACAACAGAAATTCTCCGCTTTAGGACTCAATACTCGTGATCTCGTCGTCCTCGCCG
GTCAGTAGTCTATATTTTACACAATTCAAGAAACCATTCAAGAACTATAAACCAC
CATTATTTAAAAAAAATAACGATAAAAAATCTTCATTTGTTCGTTGGACACTCGTTGAACACTTGCTAACCGTCTAGTACCTAAACATATTAAGCGCTAATCTTTCAAAAATATATTTGA
AAATCGCAACGATTCTCCATTTTTTGCCCGCCTAAAATTTCCGTTGAAAAATATTAAAATAAATTTATTGTTTATCAATTTTCAATATTTGAATAATAGCAACATATACTAAATCAATTA
CAATTTAAACAGGAGGACACACGATCGGAACAGCAGGATGTGGTGTATTCAGGAACAGGCTATTCAACACCACCGGACAACCCGCAGATCCAACCATCGACCCAACATTTTTGTCGCAGC
TTCAAACACAATGTCCCCAAAACGGCGACGCTTCAGTGCGCGTTGATCTCGACACCGGAAGCGGAACCACTTGGGATACTTCATACTACAACAACCTAAGCCGTGGCCGTGGAGTTCTCC
AATCCGATCAAGTTCTTTGGACCGATCCAGCCACTAGACCCATAGTGCAACAATTGATGGCTCCTAGAAGCACCTTCAACGTTGAGTTTGCGAGGTCAATGGTCAGGATGAGTAATATCG
GTGTAGTTACTGGGGCTAATGGGGAAATCCGTAGGGTTTGCTCTGCGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTGGTTAGATCATTGTGCTTATTCATAACCTTCCTTAGTTGTCTCATCATCTTGGTTCATGGCCAAGCCACCGGAAGGCCGGGTCCTGTTTCCGGCACAAGGATTGGGTTTTAC
TTGACCACGTGTCCTAGAGCTGAAACCATTGTCCGAAACGCCGTGAATGCTGGCTTCAGTTCTGACCCCAGAATCGCACCCGGAATACTGAGGATGCATTTCCACGACTGTTTTGTCCAA
GGTTGTGACGGTTCGATCCTTATATCGGGAGCTAACACCGAGAGAACCGCCGGTCCGAACCTCAATCTCCGAGGGTTTGAAGTCATCGACAACGCCAAAACGCAGCTCGAAGCCGCGTGT
CCAGGAGTTGTCTCGTGTGCTGATATTTTAGCCTTAGCCGCTCGTGACACAGTCATTCTC
ACGCAAGGAACAGGATGGCAAGTACCAACGGGACGTAGAGATGGCCGAGTTTCTTTGGCT
TCGAATGCTAACAATCTCCCCGGTCCACGTGATTCCGTTGCCGTACAACAACAGAAATTCTCCGCTTTAGGACTCAATACTCGTGATCTCGTCGTCCTCGCCG
GAGGACACACGATCGGA
ACAGCAGGATGTGGTGTATTCAGGAACAGGCTATTCAACACCACCGGACAACCCGCAGATCCAACCATCGACCCAACATTTTTGTCGCAGCTTCAAACACAATGTCCCCAAAACGGCGAC
GCTTCAGTGCGCGTTGATCTCGACACCGGAAGCGGAACCACTTGGGATACTTCATACTACAACAACCTAAGCCGTGGCCGTGGAGTTCTCCAATCCGATCAAGTTCTTTGGACCGATCCA
GCCACTAGACCCATAGTGCAACAATTGATGGCTCCTAGAAGCACCTTCAACGTTGAGTTTGCGAGGTCAATGGTCAGGATGAGTAATATCGGTGTAGTTACTGGGGCTAATGGGGAAATC
CGTAGGGTTTGCTCTGCGGTTAATTAA

Retrieve as FASTA