Entry information : AlyPrx38-1
Entry ID 7528
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-31 (Achraf Jemmat)
Peroxidase information: AlyPrx38-1
Name AlyPrx38-1
Class Class III peroxidase    [Orthogroup: Prx035]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx38-1
start..stop
S start..stop
AhalPrx37 692 0 1..346 1..346
AhalPrx27 652 0 1..346 1..346
AtPrx38 645 0 1..346 1..346
AlyPrx38-2 637 0 1..346 1..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18902502..18902708 207 N° 2 18902965..18903156 192 N° 3 18903254..18903422 169 N° 4 18903528..18904000 473
join(18902502..18902708,18902965..18903156,18903254..18903422,18903528..18904000 )


exon

Literature and cross-references AlyPrx38-1
DNA ref. Phytozome 12:   scaffold_6 (18902502..18904000)
Protein sequence: AlyPrx38-1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (324)
PWM (Da):   %s   37875.27 (35439.9)  
PI (pH):   %s   8 (7.70) Peptide Signal:   %s   cut: 23 range:23-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHSSLIKLGFLFLLLQVSLSHAQLSPSFYDKTCPQVFDIVTNTIVNALRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAFGNANSARGFDVIDKMKAAVEKACPRTVSCADLLAIAAQKSVVLAGGPSWMVPNGRRDSLRGFMDLANMNLPGPSSTLKVLKDRFKNVGLDRPSDLVALSGGHTFGKSQCQFIIDRLYNFGETGLPDPTLDKSYLATLRKQCPLNGNQSVLVDFDLRTPTLFDNKYYLNLKENKGLIQSDQELFSSPDAADTIPLVREYANGQGKFFDAFVNAMIRMGSLSPLTGKHGEIRLNCRVVNSKSKIMDVVDDANEFASSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCTCTTTGATAAAATTAGGATTTCTTTTTCTTCTTCTTCAGGTCTCATTGTCTCATGCTCAACTAAGCCCTTCCTTTTACGATAAAACATGTCCGCAAGTCTTTGACATTGTA
ACCAATACCATTGTCAATGCTCTGAGATCAGACCCTCGCATCGCTGCAAGCATCCTTCGTCTTCATTTCCACGACTGCTTTGTTAAT
GTAAGATACCATTAGATTCAATATATTCATGTA
TATGTAATTAACTCTTTTTGGTTCCCAATAGTTTATCCTAATGAGCGGGAATGCTTTAGGAATATTATAAACTTGAAATTAAGATAAGAAAATTTGATAGACATTTCAGTTTGTAATTTA
ACTCATATAGTTTCTTTCACGATTTATTCATTTCAAATATAAGATACTCAAACTGGAAAATTCTTTTGTTTGTATGGTTATTGAAATTTGGCTTTTGAAAAAGGGGTGTGATGCATCGAT
ATTGTTAGACAACACAACATCGTTTAGGACGGAGAAAGATGCGTTTGGCAACGCTAATTCCGCTCGAGGTTTCGATGTGATCGACAAAATGAAGGCTGCCGTAGAGAAAGCATGTCCTAG
AACTGTTTCATGTGCTGATTTGCTCGCCATCGCAGCTCAAAAATCTGTCGTTTTG
GTAAGAATCTTCTACTATGCTACCCAAATGATTTTTTAGACCATTTTGTTAATTTATAAGGAGGA
TAAAATATTTAGACCAAATATGTTTACTTTAGGCGGGAGGTCCTTCATGGATGGTTCCAAATGGAAGAAGAGACAGCTTAAGAGGGTTTATGGATCTTGCTAATATGAACCTTCCAGGTC
CATCCTCTACCCTTAAAGTACTTAAGGATAGATTCAAAAATGTCGGACTAGACCGTCCTTCTGATCTTGTTGCTCTTTCGG
GTACGTTATTATTGGAAATATTTCCACGTATAGTTGTAA
TAACTAATAACTCTACATGATTATTGGTCTTGTTTATTTATTCTTTCTATACTTTTATTTGGTTAGGTGGTCACACCTTTGGCAAAAGCCAATGTCAGTTCATAATAGATCGCCTTTACA
ACTTCGGTGAAACCGGTTTACCCGACCCAACCCTTGATAAATCTTACCTTGCCACGCTCAGAAAACAATGTCCGCTTAACGGAAACCAGAGTGTCTTGGTAGATTTTGATTTACGTACAC
CAACACTCTTTGACAATAAGTACTATTTGAATCTCAAAGAGAACAAAGGACTGATCCAGAGCGACCAAGAGTTATTCTCTAGCCCGGATGCTGCAGATACTATCCCTTTAGTCCGAGAAT
ACGCTAATGGTCAAGGGAAATTTTTCGATGCGTTCGTAAATGCAATGATAAGGATGGGAAGCCTTTCACCTTTAACAGGGAAACATGGAGAAATTAGATTGAATTGTAGAGTGGTGAATT
CGAAATCGAAAATCATGGATGTGGTGGATGATGCAAATGAATTTGCCAGTTCAATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCTCTTTGATAAAATTAGGATTTCTTTTTCTTCTTCTTCAGGTCTCATTGTCTCATGCTCAACTAAGCCCTTCCTTTTACGATAAAACATGTCCGCAAGTCTTTGACATTGTA
ACCAATACCATTGTCAATGCTCTGAGATCAGACCCTCGCATCGCTGCAAGCATCCTTCGTCTTCATTTCCACGACTGCTTTGTTAAT
GGGTGTGATGCATCGATATTGTTAGACAACACA
ACATCGTTTAGGACGGAGAAAGATGCGTTTGGCAACGCTAATTCCGCTCGAGGTTTCGATGTGATCGACAAAATGAAGGCTGCCGTAGAGAAAGCATGTCCTAGAACTGTTTCATGTGCT
GATTTGCTCGCCATCGCAGCTCAAAAATCTGTCGTTTTG
GCGGGAGGTCCTTCATGGATGGTTCCAAATGGAAGAAGAGACAGCTTAAGAGGGTTTATGGATCTTGCTAATATGAACCTT
CCAGGTCCATCCTCTACCCTTAAAGTACTTAAGGATAGATTCAAAAATGTCGGACTAGACCGTCCTTCTGATCTTGTTGCTCTTTCGG
GTGGTCACACCTTTGGCAAAAGCCAATGTCAG
TTCATAATAGATCGCCTTTACAACTTCGGTGAAACCGGTTTACCCGACCCAACCCTTGATAAATCTTACCTTGCCACGCTCAGAAAACAATGTCCGCTTAACGGAAACCAGAGTGTCTTG
GTAGATTTTGATTTACGTACACCAACACTCTTTGACAATAAGTACTATTTGAATCTCAAAGAGAACAAAGGACTGATCCAGAGCGACCAAGAGTTATTCTCTAGCCCGGATGCTGCAGAT
ACTATCCCTTTAGTCCGAGAATACGCTAATGGTCAAGGGAAATTTTTCGATGCGTTCGTAAATGCAATGATAAGGATGGGAAGCCTTTCACCTTTAACAGGGAAACATGGAGAAATTAGA
TTGAATTGTAGAGTGGTGAATTCGAAATCGAAAATCATGGATGTGGTGGATGATGCAAATGAATTTGCCAGTTCAATGTGA

Retrieve as FASTA