Entry information : AlyPrx29
Entry ID 7529
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx29
Name AlyPrx29
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx29
start..stop
S start..stop
AhalPrx23 678 0 1..339 1..339
AtPrx29 663 0 1..339 1..339
BstrPrx17 653 0 1..339 1..339
CagraPrx54 627 0 1..339 1..341
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7274320..7274568 249 N° 2 7275552..7275912 361 N° 3 7276007..7276416 410  
join(7274320..7274568,7275552..7275912,7276007..7276416)


exon

Literature and cross-references AlyPrx29
DNA ref. Phytozome 12:   scaffold_3 (7274320..7276416)
Protein sequence: AlyPrx29
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (308)
PWM (Da):   %s   36429.03 (33247.5)  
PI (pH):   %s   4.7 (4.60) Peptide Signal:   %s   cut: 32 range:32-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPKSKVAESAAASCFLVMSLICSSINGEQAETNYEGLSYSYYEKTCPKVEEIVRSSLSSMFILDPTSPAALLRLMFHDCQVQGCDASILLEPSGDQQFTELDSAKNFGIRKRDLIGSIKTSLELECPKQVSCSDVIILAARDAVALTGGPLIAVPLGRKDSLSTPSKHVADSKLPPSTADVDTTLNLFASKGMTIEESVAIMGAHTIGVTHCNNVLSRFDNANATSENMDPRFQTFLRVACPEFSPTSQAAEATFVPNDQTSVIFDTAYYDDAIAGRGNLRIDSEIGADPRTRPFVEAFAADQDRFFNAFSSAFVKLSSYKVLTGSEGVVRSVCDKAD

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, introns 1 and 3).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCAAAGAGCAAAGTTGCAGAATCCGCAGCTGCATCATGTTTTCTTGTCATGAGCTTGATATGCAGCTCCATTAATGGTGAGCAAGCGGAGACGAATTATGAAGGATTATCTTAC
AGTTACTACGAGAAGACTTGTCCTAAAGTCGAAGAGATCGTGAGATCTTCTCTTTCATCAATGTTTATACTTGACCCTACTTCTCCTGCAGCCTTGCTAAGGCTTATGTTTCATGACTGC
CAAGTTCAG
GTTCTCTACCTCTAGCCAAATCCATCTCTCATTCTCACTCTAAGAAAATTCTCAATTTATGTTTGGGATTCGAATTTATACACTTTGTGAATAAACGTATCCAGATATCAT
GATTAGGATCGCCAATTATGTAATGATTATTCCGTCAATAATATTACGAAAACTAGACGTTCGTTTTTGTTTTTTTTTTTCTAACATGAGCTTTCGTTTTTTAAAAAAATTTGTTTTTAT
AACAAACAAAAGTTTGATATGCTTTATACACAATTTTAAAATTTTGCCAACTACGTAATTTCTCTTGCATGTTAACGATAAATTTAGAAGACAACAAGATGCGGAAATTTTAATTAAAAA
ATAAATAAACAAGATGTCACTTTAATTAGTTAAACATGTCACGGTCCATTGTGGACTATATGTGACGAATGGATAATGTTGTTTCATATTTAAGTGCACATCATGTCATTTACAACATGG
GAATATAATGGGTTTGTGTCTAAAATTATAGGCATGTTTTTATTCTTCATAATCATACTAATGTTTATATTTAGCTTAAATTTATAGGCATGTTGCCAAAAACTAAATCATAAGCTAAAT
AGCAACATTATTATTTTGTTTTAATTTTTTGGTTAAATATAGCAACATTAATTGATTAATCAATCGGATACGTACGAAAAACATATATAATGGTCGAGTATTGGATATCTGGATATGATC
ACATGCTAATCTGAGTTAATACAAATATACAATTTATGGACAGTACATACAATACATGCATGAAATTCACTGTTTTATACTATAATCCACAATATTAACATTTTTTATAAAGGTTTTTTT
TTCCGACATAGATAAGTCGCAAATTTTGGTTTCCATACTCTTCTAAAGAGATGGAGAAAAACTCGAATTAGATAATTGTTCTTGGTATTTATTTCATCTCATCAGCAATATCATTAATTG
TCGGGAACAAAAATATGTGGCTTATGTGACAGGGCTGTGACGCATCAATCCTACTCGAGCCAAGTGGGGACCAACAATTCACTGAGCTTGATTCAGCCAAGAACTTCGGAATCAGAAAGA
GGGACCTGATTGGCTCTATCAAAACCTCACTGGAGCTTGAGTGTCCCAAGCAAGTCTCATGCTCCGACGTCATCATCCTCGCCGCCAGAGACGCCGTGGCTCTCACGGGAGGTCCACTCA
TCGCTGTGCCATTAGGACGAAAAGACTCTCTCTCTACTCCAAGCAAACACGTGGCAGACTCTAAGCTTCCTCCCTCCACTGCTGACGTGGACACTACCTTAAACCTCTTTGCAAGCAAAG
GCATGACCATTGAAGAGTCCGTAGCCATCATGG
GTATATAAACTTTTATTCCTTATTTCTTATAATAAGACTCTGAATTAATTATAGTGCATATTTAATTCAGATAATTAGATTTCTTCT
CTTGTAGGTGCACATACGATAGGAGTCACACATTGCAACAACGTATTATCGCGTTTCGATAACGCAAACGCGACAAGTGAGAACATGGATCCACGTTTTCAAACGTTTTTGCGTGTGGCT
TGTCCAGAGTTTTCTCCAACTTCTCAAGCTGCGGAAGCCACATTTGTCCCCAACGATCAAACTTCAGTGATCTTCGATACAGCTTATTACGATGATGCAATCGCGGGACGTGGAAATCTT
AGAATTGACTCGGAGATTGGAGCTGATCCACGTACACGTCCGTTTGTCGAAGCGTTTGCGGCTGACCAAGACCGCTTCTTCAACGCTTTCTCTTCCGCGTTTGTAAAATTGTCGTCTTAC
AAAGTGTTAACCGGGAGTGAAGGAGTAGTTAGAAGCGTATGTGACAAGGCTGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCAAAGAGCAAAGTTGCAGAATCCGCAGCTGCATCATGTTTTCTTGTCATGAGCTTGATATGCAGCTCCATTAATGGTGAGCAAGCGGAGACGAATTATGAAGGATTATCTTAC
AGTTACTACGAGAAGACTTGTCCTAAAGTCGAAGAGATCGTGAGATCTTCTCTTTCATCAATGTTTATACTTGACCCTACTTCTCCTGCAGCCTTGCTAAGGCTTATGTTTCATGACTGC
CAAGTTCAG
GGCTGTGACGCATCAATCCTACTCGAGCCAAGTGGGGACCAACAATTCACTGAGCTTGATTCAGCCAAGAACTTCGGAATCAGAAAGAGGGACCTGATTGGCTCTATCAAA
ACCTCACTGGAGCTTGAGTGTCCCAAGCAAGTCTCATGCTCCGACGTCATCATCCTCGCCGCCAGAGACGCCGTGGCTCTCACGGGAGGTCCACTCATCGCTGTGCCATTAGGACGAAAA
GACTCTCTCTCTACTCCAAGCAAACACGTGGCAGACTCTAAGCTTCCTCCCTCCACTGCTGACGTGGACACTACCTTAAACCTCTTTGCAAGCAAAGGCATGACCATTGAAGAGTCCGTA
GCCATCATGG
GTGCACATACGATAGGAGTCACACATTGCAACAACGTATTATCGCGTTTCGATAACGCAAACGCGACAAGTGAGAACATGGATCCACGTTTTCAAACGTTTTTGCGTGTG
GCTTGTCCAGAGTTTTCTCCAACTTCTCAAGCTGCGGAAGCCACATTTGTCCCCAACGATCAAACTTCAGTGATCTTCGATACAGCTTATTACGATGATGCAATCGCGGGACGTGGAAAT
CTTAGAATTGACTCGGAGATTGGAGCTGATCCACGTACACGTCCGTTTGTCGAAGCGTTTGCGGCTGACCAAGACCGCTTCTTCAACGCTTTCTCTTCCGCGTTTGTAAAATTGTCGTCT
TACAAAGTGTTAACCGGGAGTGAAGGAGTAGTTAGAAGCGTATGTGACAAGGCTGACTGA

Retrieve as FASTA