Entry information : AlyPrx27
Entry ID 7534
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx27
Name AlyPrx27
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx27
start..stop
S start..stop
AhalPrx60 655 0 1..321 1..321
AtPrx27 636 0 1..321 1..321
CrubPrx100 618 0 1..318 1..318
CagraPrx37 615 0 1..321 1..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 359018..359230 213 N° 2 359367..359552 186 N° 3 359633..359792 160 N° 4 359888..360294 407
join(359018..359230,359367..359552,359633..359792,359888..360294)


exon

Literature and cross-references AlyPrx27
DNA ref. Phytozome 12:   scaffold_3 (359018..360294)
Protein sequence: AlyPrx27
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (298)
PWM (Da):   %s   34795.91 (32319.5)  
PI (pH):   %s   9.3 (8.91) Peptide Signal:   %s   cut: 24 range:24-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASKRLVVSCLFLVLLFAQAKSQGLKVGFYSKTCPQVEGIVRKVVFDAMKKAPTVGAPLLRMFFHDCFVRGCDGSILLDKPNNQGEKSAVPNLSLRGFGIIDDSKAALEKVCPGIVSCSDVLALIARDAMVALEGPSWEVETGRRDGRVSNINEVNLPSPFDNITKLINDFRAKGLNEKDLVVLSGGHTIGMGHCPLLTNRLYNFTGKGDSDPSLDTEYAAKLRQKCKPTDTTTALEMDPGSFKTFDVSYFTLVAKRRGLFQSDAALLDNSKTRAYVLQQARTHGSMFFSDFGVSMVKMGRIGVLTGQAGEIRKTCRSAN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTTCTAAGCGACTAGTTGTCTCTTGCTTGTTCTTAGTGTTGTTGTTTGCTCAAGCCAAATCACAAGGTTTGAAAGTAGGGTTCTACAGCAAAACATGCCCACAAGTCGAGGGT
ATTGTTAGAAAGGTAGTGTTCGATGCGATGAAGAAAGCACCTACAGTTGGTGCTCCTTTGCTTAGAATGTTCTTCCACGACTGCTTCGTTCGG
GTATGTTTCTGAAATGAATCATGATTT
TTATATCTTTCTTATGTCACGTTAGTTTCTTAACAACGTGAGATTTCTAGCAAAGCTAGAGTTGTATTCATCAATTGCCTATTTAATGAGTGAATCGTATAATCAATAGGGATGTGACGG
ATCAATCTTGCTAGATAAACCGAACAATCAAGGTGAGAAGAGTGCGGTTCCTAACCTAAGCCTTCGAGGTTTTGGTATCATAGACGATTCCAAGGCGGCTCTAGAAAAAGTTTGTCCGGG
AATTGTTTCTTGCTCTGATGTCTTGGCACTTATCGCTAGAGACGCAATGGTTGCA
GTAAGTAATCTTCACATAAATACAAAATTTCTACATACACATAACACATATATAGAGCTCATGAA
TATGTTAATTTTTAGCTTGAAGGACCATCGTGGGAAGTTGAAACTGGAAGAAGAGACGGTAGGGTTTCTAATATCAACGAAGTCAACTTGCCATCACCTTTTGATAACATCACCAAGCTT
ATCAACGATTTTCGCGCAAAGGGCCTCAACGAGAAGGATCTAGTCGTTCTCTCAG
GTACGTAAGAGTGAATGATATATATTAGTCTGAAAAATGAATAATTAATTAGAAATCTGTTTGGG
TAATGGAAAATATACATGTTTTTTCTAAAGGTGGGCACACTATTGGAATGGGACATTGTCCTCTATTGACAAACCGGCTTTACAATTTCACCGGAAAAGGAGACAGCGACCCGAGTTTGG
ACACAGAGTACGCTGCTAAGCTCAGGCAGAAATGCAAGCCCACCGATACCACGACGGCTCTAGAGATGGATCCGGGGAGTTTCAAAACATTCGACGTGAGCTACTTCACGCTAGTGGCTA
AGAGAAGAGGACTTTTCCAGTCGGATGCTGCTCTATTGGACAACTCCAAGACTAGGGCTTATGTCTTGCAACAGGCAAGAACTCATGGGTCAATGTTCTTTAGTGACTTTGGTGTCTCAA
TGGTGAAAATGGGTCGGATCGGAGTTCTTACGGGTCAGGCCGGGGAGATCCGTAAGACGTGTCGGTCTGCTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTTCTAAGCGACTAGTTGTCTCTTGCTTGTTCTTAGTGTTGTTGTTTGCTCAAGCCAAATCACAAGGTTTGAAAGTAGGGTTCTACAGCAAAACATGCCCACAAGTCGAGGGT
ATTGTTAGAAAGGTAGTGTTCGATGCGATGAAGAAAGCACCTACAGTTGGTGCTCCTTTGCTTAGAATGTTCTTCCACGACTGCTTCGTTCGG
GGATGTGACGGATCAATCTTGCTAGAT
AAACCGAACAATCAAGGTGAGAAGAGTGCGGTTCCTAACCTAAGCCTTCGAGGTTTTGGTATCATAGACGATTCCAAGGCGGCTCTAGAAAAAGTTTGTCCGGGAATTGTTTCTTGCTCT
GATGTCTTGGCACTTATCGCTAGAGACGCAATGGTTGCA
CTTGAAGGACCATCGTGGGAAGTTGAAACTGGAAGAAGAGACGGTAGGGTTTCTAATATCAACGAAGTCAACTTGCCATCA
CCTTTTGATAACATCACCAAGCTTATCAACGATTTTCGCGCAAAGGGCCTCAACGAGAAGGATCTAGTCGTTCTCTCAG
GTGGGCACACTATTGGAATGGGACATTGTCCTCTATTGACA
AACCGGCTTTACAATTTCACCGGAAAAGGAGACAGCGACCCGAGTTTGGACACAGAGTACGCTGCTAAGCTCAGGCAGAAATGCAAGCCCACCGATACCACGACGGCTCTAGAGATGGAT
CCGGGGAGTTTCAAAACATTCGACGTGAGCTACTTCACGCTAGTGGCTAAGAGAAGAGGACTTTTCCAGTCGGATGCTGCTCTATTGGACAACTCCAAGACTAGGGCTTATGTCTTGCAA
CAGGCAAGAACTCATGGGTCAATGTTCTTTAGTGACTTTGGTGTCTCAATGGTGAAAATGGGTCGGATCGGAGTTCTTACGGGTCAGGCCGGGGAGATCCGTAAGACGTGTCGGTCTGCT
AATTAA

Retrieve as FASTA