Entry information : AlyPrx70
Entry ID 7537
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx70
Name AlyPrx70
Class Class III peroxidase    [Orthogroup: Prx087]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx70
start..stop
S start..stop
AtPrx70 643 0 1..332 1..330
BstrPrx73 613 0 1..332 1..331
CrubPrx81 593 0 1..332 1..331
TsPrx70 555 0 1..332 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21305818..21306240 423 N° 2 21305531..21305690 160 N° 3 21304511..21304926 416  
complement(join(21304511..21304926,21305531..21305690,21305818..21306240))


exon

Literature and cross-references AlyPrx70
DNA ref. Phytozome 12:   scaffold_8 (21306240..21304511)
Protein sequence: AlyPrx70
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (306)
PWM (Da):   %s   36065.43 (33282.0) Transmb domain:   %s   i7-26o
PI (pH):   %s   6.87 (6.88) Peptide Signal:   %s   cut: 27 range:27-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSSTNFNPCYVNVLLPFFLVLAANATHKNFFLPRPRIGYYGSACWNVESIVRSVVESNYLANPANAPGILRMHFHDCFVQGCDASVLLAGPNSERTAIPNLSLRGFNVIEEAKTQLEIACPRTVSCADILALAARDFVSLAGGPWWPVPLGRLDGRVSLASNVILPGPTDSVAVQKLRFAEKNLNTQDLVVLAAGHTIGTAGCVVFRDRFFNYDNTGSPDPTIAPSFVPQIQAQCPLNGDPATRVVLDTGSGDQFDTSYLNNLRNGRGLLESDQVLWTNPETRPIVERLLGLRFPFLIFGLEFARSMTKMSQIEVKTGLDGEIRRVCSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, introns 2 and 3)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGTTCTACTAATTTTAATCCTTGCTACGTTAACGTTCTCTTACCGTTTTTCCTTGTCCTAGCCGCGAATGCAACACATAAAAACTTTTTCCTCCCAAGGCCACGGATCGGGTAT
TACGGTAGTGCATGCTGGAATGTAGAATCGATAGTGCGGTCCGTGGTCGAGTCTAACTATCTTGCTAATCCAGCTAATGCTCCGGGCATTTTGCGTATGCACTTTCACGATTGTTTCGTC
CAAGGCTGTGACGCCTCCGTTCTCCTAGCCGGACCTAACTCCGAGAGAACGGCGATTCCGAATCTATCGTTGAGAGGGTTTAATGTCATCGAAGAAGCTAAGACGCAGCTTGAGATCGCT
TGTCCTCGAACTGTCTCTTGTGCTGATATTCTCGCACTCGCTGCACGCGACTTCGTCAGTTTG
GTATAACTTACTTTTATAATTTTATTTATATACACAAGTCTATCGTGCGTCTTGGTT
TTAACGTCACATGCATATATGTTTATCTATTGATCGTGATTAAGTGAAAGTTTTATATGTATGTATATAGGCCGGTGGACCATGGTGGCCAGTTCCATTGGGGCGACTCGATGGCCGGGT
TTCGCTAGCCTCGAATGTCATTTTGCCGGGACCTACCGACTCCGTTGCCGTACAGAAGCTGAGGTTCGCCGAAAAAAATCTTAATACCCAAGATCTCGTTGTCCTTGCTG
GTACGTTGTA
GATTTTAGGCCTCGATCGCTTGTGTTAAACATTGTTTTTACGATTTTGCTTTGCATGTGAAAATTTTACTTTTTTGAAAGATTTCTGCAAAATACATACGTAAACACCAAACAAATCGTT
TACGTTTACACTAACAACTAAATTAATTTTGTATTCATTTTAAGATATTTTAAATATATGTAAACGTAAATAAACAATCGAAGCTGTACAGTGCAATTTTATAGAGTTTCGATATATATA
AGCCCGATCCATAGCCAATCGAAGCTGTACGGTGTAATTTTATAGAGTTTCGATATATATAACTGAAGAGTACAAAGTCTATGACACTAAGTCTTTTTTTTTTTTGGGGGGGGGGGGCAA
AAAAAGAGTTAATTAACCAGTATATATATATATGTGTATTTAATATTGGGACAATAATTATATTTGTAATAGCTTGGTATACATTTTACATTATCTCACAATTTATTGCATCCTACGTTA
GCTTAGCATTCAAAGGAGATAATAAATACTTTTTGTTTATTACAAATTACATATATATTTTGAAATTGTCTCGAGATACCATCTAACTCACATAGAGGGCTTGGTATATAACAGCTGGAC
ACACGATAGGAACGGCCGGGTGTGTTGTGTTTAGGGACAGATTCTTCAACTACGACAACACAGGAAGTCCGGACCCAACCATCGCCCCGAGTTTCGTCCCTCAGATCCAAGCTCAATGTC
CTCTGAACGGTGACCCTGCGACTCGTGTAGTGCTGGACACGGGAAGTGGAGACCAATTCGATACGTCGTACCTTAACAACTTGAGGAACGGTCGAGGTCTCCTCGAGTCTGATCAGGTCC
TATGGACTAACCCTGAGACCCGACCCATCGTGGAACGGCTTCTAGGACTACGATTTCCGTTTCTTATTTTCGGACTGGAGTTCGCGAGGTCCATGACCAAGATGAGTCAGATCGAGGTCA
AGACGGGTTTGGACGGGGAGATTCGTAGGGTTTGTTCTGCGGTTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGTTCTACTAATTTTAATCCTTGCTACGTTAACGTTCTCTTACCGTTTTTCCTTGTCCTAGCCGCGAATGCAACACATAAAAACTTTTTCCTCCCAAGGCCACGGATCGGGTAT
TACGGTAGTGCATGCTGGAATGTAGAATCGATAGTGCGGTCCGTGGTCGAGTCTAACTATCTTGCTAATCCAGCTAATGCTCCGGGCATTTTGCGTATGCACTTTCACGATTGTTTCGTC
CAAGGCTGTGACGCCTCCGTTCTCCTAGCCGGACCTAACTCCGAGAGAACGGCGATTCCGAATCTATCGTTGAGAGGGTTTAATGTCATCGAAGAAGCTAAGACGCAGCTTGAGATCGCT
TGTCCTCGAACTGTCTCTTGTGCTGATATTCTCGCACTCGCTGCACGCGACTTCGTCAGTTTG
GCCGGTGGACCATGGTGGCCAGTTCCATTGGGGCGACTCGATGGCCGGGTTTCGCTA
GCCTCGAATGTCATTTTGCCGGGACCTACCGACTCCGTTGCCGTACAGAAGCTGAGGTTCGCCGAAAAAAATCTTAATACCCAAGATCTCGTTGTCCTTGCTG
CTGGACACACGATAGGA
ACGGCCGGGTGTGTTGTGTTTAGGGACAGATTCTTCAACTACGACAACACAGGAAGTCCGGACCCAACCATCGCCCCGAGTTTCGTCCCTCAGATCCAAGCTCAATGTCCTCTGAACGGT
GACCCTGCGACTCGTGTAGTGCTGGACACGGGAAGTGGAGACCAATTCGATACGTCGTACCTTAACAACTTGAGGAACGGTCGAGGTCTCCTCGAGTCTGATCAGGTCCTATGGACTAAC
CCTGAGACCCGACCCATCGTGGAACGGCTTCTAGGACTACGATTTCCGTTTCTTATTTTCGGACTGGAGTTCGCGAGGTCCATGACCAAGATGAGTCAGATCGAGGTCAAGACGGGTTTG
GACGGGGAGATTCGTAGGGTTTGTTCTGCGGTTAACTGA

Retrieve as FASTA