Entry information : AlyPrx52
Entry ID 7538
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx52
Name AlyPrx52
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx52
start..stop
S start..stop
AhalPrx44 652 0 1..324 1..324
AruPrx52 623 0 1..324 1..324
BstrPrx47 622 0 1..324 1..324
AtPrx52 621 0 1..324 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1936403..1936627 225 N° 2 1936100..1936291 192 N° 3 1935843..1936008 166 N° 4 1934948..1935339 392
complement(join(1934948..1935339,1935843..1936008,1936100..1936291,1936403..1936 627))


exon

Literature and cross-references AlyPrx52
DNA ref. Phytozome 12:   scaffold_6 (1936627..1934948)
Protein sequence: AlyPrx52
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (296)
PWM (Da):   %s   34013.93 (31067.3)  
PI (pH):   %s   8.4 (8.58) Peptide Signal:   %s   cut: 29 range:29-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASNQLTAILVLVLTLLLQGNNNNVVEAQLTTNFYSTSCPNLLSTVQSAVKSAVNSEARMGASILRLFFHDCFVNGCDGSILLDDTSSFTGEQNAAPNRNSARGFNVIDNIKSAVEKACPGVVSCADILAIAARDSVVVLGGPNWNVKVGRRDARTASQAAANSNIPAPTSSLSQLISSFSAVGLSTRDMVALSGAHTIGQSRCTNFRARIYNETNINAAFATTRQRTCPRATGSGDGNLAPLDVTTAASFDNNYFKNLMTQRGLLHSDQVLFNGGSTDSIVRGYSNNPSSFNSDFAAAMIKMGDISPLTGSSGEIRKVCGRTN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAAATCAACTTACTGCTATTCTAGTTCTCGTACTTACACTTTTACTCCAAGGTAATAACAATAACGTCGTCGAAGCACAACTCACGACTAATTTCTACTCAACCTCTTGCCCT
AACCTCCTCTCCACCGTCCAAAGCGCCGTTAAATCTGCCGTTAACAGCGAGGCTCGAATGGGTGCATCTATCCTCCGTCTCTTCTTCCACGATTGCTTCGTCAAC
GTAGTTTTTTTTTCT
TTTACCTTTTTTTTGTTTTCCTTGCATCTCAAGAAACTTAGCATAATTTTTATTTTGGTTCTTTACTTCTAACCACTGTCATGCTTACATATATAGGGATGTGACGGTTCGATTCTGCTA
GATGACACGTCGAGCTTCACAGGAGAACAAAACGCGGCCCCAAACCGCAATTCAGCTCGTGGGTTTAATGTGATCGACAACATCAAATCAGCGGTTGAGAAAGCATGTCCCGGGGTTGTG
TCTTGTGCTGATATCTTAGCCATTGCAGCTAGAGACTCCGTCGTAGTC
GTAAGCTCCCTATTTCCTCTCTTAGTCTGGTTTTGAAAATTTAAAAGATTAAACCGGTCTAAAACATGAATT
TGTCTCTATTTTGTTGAAGCTTGGAGGGCCGAATTGGAATGTTAAAGTAGGAAGAAGAGATGCAAGAACGGCGAGTCAAGCGGCAGCGAATAGTAACATTCCGGCCCCGACTTCGAGTCT
GAGCCAACTCATTAGTAGTTTCAGTGCTGTTGGACTCTCCACCAGAGATATGGTTGCTCTCTCCG
GTTCGTTTCACTTCTCTTCTTGCTTAACCCAATTCCCATTTATTATTTACGCAAC
TATATATGTATCACAGATTAAGGTTGATTGCAATTTTTCAAACATCGATTACTAATAGATTGCTAAAAATTGGTGACAAAAATTATTTCTTAATCTGTGAATATTTCTTAAATTTTATTC
GTTCACCAATTTGTTTAACAAAAAGAAACATAAAAAGAAATATTTCAAAGGACCAACACAACAGTCAACAGAGTCGACACAAAATAATATAATTTGATTGTGTTGTTTGTTTTTGTCGAC
TTTTTTTCAACACATTTTTGTAACGCACCACCGACTTTTCTGTTTTTTTTTTTTCCCAAACAAAATTACGTAATCATATTTTTTCCCAAAATTACGTAATCATATAAATTACTGTTACGC
AACACCGACAAAGTAATTCAGATGATCCTTAAAATAATTAAGTCAACTATTAAACTAATCATTCAAACTTTTTTGTTTTTGTTTTCAGGCGCACACACGATCGGACAATCCCGTTGCACG
AACTTCCGAGCGAGAATCTACAACGAGACAAACATCAACGCCGCCTTCGCCACCACACGTCAACGAACTTGCCCTAGAGCCACCGGTTCCGGCGACGGAAACCTAGCTCCACTAGACGTC
ACCACGGCGGCTTCCTTCGACAACAACTACTTCAAGAATCTCATGACTCAGAGAGGTCTCCTCCATTCCGACCAAGTGCTCTTCAACGGAGGCTCCACTGACTCCATTGTCCGTGGATAC
AGCAACAATCCATCGAGCTTTAACTCTGACTTCGCGGCGGCGATGATCAAGATGGGTGATATCAGCCCGTTGACTGGTAGTAGCGGTGAAATCCGCAAGGTTTGCGGGAGGACCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAAATCAACTTACTGCTATTCTAGTTCTCGTACTTACACTTTTACTCCAAGGTAATAACAATAACGTCGTCGAAGCACAACTCACGACTAATTTCTACTCAACCTCTTGCCCT
AACCTCCTCTCCACCGTCCAAAGCGCCGTTAAATCTGCCGTTAACAGCGAGGCTCGAATGGGTGCATCTATCCTCCGTCTCTTCTTCCACGATTGCTTCGTCAAC
GGATGTGACGGTTCG
ATTCTGCTAGATGACACGTCGAGCTTCACAGGAGAACAAAACGCGGCCCCAAACCGCAATTCAGCTCGTGGGTTTAATGTGATCGACAACATCAAATCAGCGGTTGAGAAAGCATGTCCC
GGGGTTGTGTCTTGTGCTGATATCTTAGCCATTGCAGCTAGAGACTCCGTCGTAGTC
CTTGGAGGGCCGAATTGGAATGTTAAAGTAGGAAGAAGAGATGCAAGAACGGCGAGTCAAGCG
GCAGCGAATAGTAACATTCCGGCCCCGACTTCGAGTCTGAGCCAACTCATTAGTAGTTTCAGTGCTGTTGGACTCTCCACCAGAGATATGGTTGCTCTCTCCG
GCGCACACACGATCGGA
CAATCCCGTTGCACGAACTTCCGAGCGAGAATCTACAACGAGACAAACATCAACGCCGCCTTCGCCACCACACGTCAACGAACTTGCCCTAGAGCCACCGGTTCCGGCGACGGAAACCTA
GCTCCACTAGACGTCACCACGGCGGCTTCCTTCGACAACAACTACTTCAAGAATCTCATGACTCAGAGAGGTCTCCTCCATTCCGACCAAGTGCTCTTCAACGGAGGCTCCACTGACTCC
ATTGTCCGTGGATACAGCAACAATCCATCGAGCTTTAACTCTGACTTCGCGGCGGCGATGATCAAGATGGGTGATATCAGCCCGTTGACTGGTAGTAGCGGTGAAATCCGCAAGGTTTGC
GGGAGGACCAACTGA

Retrieve as FASTA