Entry information : AlyPrx36 (AL5G31410)
Entry ID 7539
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-06 (Christophe Dunand)
Peroxidase information: AlyPrx36 (AL5G31410)
Name (synonym) AlyPrx36 (AL5G31410)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx36
start..stop
S start..stop
AtPrx36 665 0 1..340 1..343
CagraPrx19 634 0 5..341 1..336
CrubPrx36 627 0 10..341 1..332
CsativPrx36 619 0 5..340 1..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15462544..15462792 249 N° 2 15462885..15463076 192 N° 3 15463159..15463324 166 N° 4 15463577..15463995 419
join(15462544..15462792,15462885..15463076,15463159..15463324,15463577..15463995 )


exon

Literature and cross-references AlyPrx36 (AL5G31410)
DNA ref. Phytozome 12:   scaffold_5 (15462544..15463995)
Protein sequence: AlyPrx36 (AL5G31410)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (321)
PWM (Da):   %s   37723.23 (35556.0)  
PI (pH):   %s   4.68 (4.55) Peptide Signal:   %s   cut: 21 range:21-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNTKMVKSMVVLAQIPLVALFPLCICYQTHESTSSASLSPQFYDNSCPNAQAIVQSYVAKAYSNDPRMAASILRLHFHDCFVNGCDASVLLDSSGTMESEKRSNANRDSARGFEVIDEIKSALENECPETVSCADLLALVARDSIVICGGPSWEVNLGRRDAREASLSGSMENIPSPESTLQTIVNMFNLQGLDLTDLVALLGSHTIGNSRCIGFRQRLYNHTGNNDPDQTLNQDYASMLQQGCPISGNDQNLFNLDYVTPTKFDNYYFKNLVNFRGLLSSDEILFTQSSETMEMVKFYAENEEAFFEQFAKSIVKMGNISPLTGTDGEIRRICRRVNHDF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns. Incorrect prediction from Phytozome (extra intron in 5').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATACAAAAATGGTGAAGTCAATGGTTGTTCTTGCCCAAATCCCACTTGTTGCGCTGTTTCCTCTTTGTATATGTTATCAAACACATGAAAGCACGAGTTCTGCCTCTCTATCCCCT
CAGTTTTACGACAACTCGTGCCCAAACGCACAAGCCATCGTTCAATCTTACGTCGCCAAAGCATATTCCAATGACCCTCGCATGGCTGCCTCAATTCTTAGGCTCCATTTCCATGACTGT
TTCGTTAAT
GTTTGACAAAATCTAGTCTATTCTTCAAATATATAATGTTTGATATAAATAAGGACAAATGTTAGTTGATATATAGACTTTGGTTGGTGCAGGGATGTGATGCTTCCGTAC
TATTGGACAGTAGTGGAACCATGGAAAGCGAGAAACGATCAAATGCAAATCGAGACTCTGCTCGAGGGTTCGAAGTCATTGACGAGATCAAGTCGGCCTTGGAAAATGAATGTCCTGAAA
CAGTTTCTTGCGCCGATCTATTGGCTCTCGTTGCTAGAGACTCCATTGTTATT
GTAAGTCAATTCTCTAACAATAGAAGTATAGAACTAATATATAATTGTTACAAACACTCGTTAATTT
TGTAATTATCTACAGTGTGGTGGACCTAGTTGGGAAGTAAATCTTGGAAGAAGAGATGCAAGGGAAGCAAGTTTGAGTGGTTCCATGGAGAACATTCCTTCTCCCGAGTCCACGTTACAA
ACAATTGTCAACATGTTCAACCTTCAAGGACTTGATCTCACCGATCTTGTTGCCCTCTTAG
GTATATATATATGGTATCCAAGAGAACTTTTTATGGAAGAAACTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTGAGAATAAAGAAACTTAAGTAAGAGAATAAAGAAATGTTATAAATAACGATGTGTGATTGTGATTGGATAAAAAAACGTTATCTTATCTCTCACAAGTTCTATTAA
AGATTAAAGATATAAACTAACACATATTGATAAATTATCATTTCTAAAACTAATAACCATGATTTAAATGTAGGGAGTCACACGATAGGAAACTCGAGGTGTATTGGTTTCCGACAAAGG
TTATACAACCATACTGGAAACAACGATCCCGACCAGACTTTGAATCAAGACTACGCCTCTATGTTGCAGCAGGGATGTCCGATTTCGGGCAACGACCAGAACCTCTTTAATCTTGACTAC
GTGACGCCAACTAAGTTTGACAATTACTACTTCAAGAATCTGGTGAACTTTAGAGGACTCTTGAGTTCTGATGAGATTTTGTTCACGCAAAGCAGTGAGACCATGGAGATGGTCAAGTTT
TACGCGGAGAATGAGGAAGCCTTCTTTGAGCAGTTCGCGAAGTCGATTGTGAAGATGGGGAACATCTCACCGTTGACGGGGACAGATGGTGAGATCAGGAGGATCTGCCGGAGGGTTAAC
CATGATTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATACAAAAATGGTGAAGTCAATGGTTGTTCTTGCCCAAATCCCACTTGTTGCGCTGTTTCCTCTTTGTATATGTTATCAAACACATGAAAGCACGAGTTCTGCCTCTCTATCCCCT
CAGTTTTACGACAACTCGTGCCCAAACGCACAAGCCATCGTTCAATCTTACGTCGCCAAAGCATATTCCAATGACCCTCGCATGGCTGCCTCAATTCTTAGGCTCCATTTCCATGACTGT
TTCGTTAAT
GGATGTGATGCTTCCGTACTATTGGACAGTAGTGGAACCATGGAAAGCGAGAAACGATCAAATGCAAATCGAGACTCTGCTCGAGGGTTCGAAGTCATTGACGAGATCAAG
TCGGCCTTGGAAAATGAATGTCCTGAAACAGTTTCTTGCGCCGATCTATTGGCTCTCGTTGCTAGAGACTCCATTGTTATT
TGTGGTGGACCTAGTTGGGAAGTAAATCTTGGAAGAAGA
GATGCAAGGGAAGCAAGTTTGAGTGGTTCCATGGAGAACATTCCTTCTCCCGAGTCCACGTTACAAACAATTGTCAACATGTTCAACCTTCAAGGACTTGATCTCACCGATCTTGTTGCC
CTCTTAG
GGAGTCACACGATAGGAAACTCGAGGTGTATTGGTTTCCGACAAAGGTTATACAACCATACTGGAAACAACGATCCCGACCAGACTTTGAATCAAGACTACGCCTCTATGTTG
CAGCAGGGATGTCCGATTTCGGGCAACGACCAGAACCTCTTTAATCTTGACTACGTGACGCCAACTAAGTTTGACAATTACTACTTCAAGAATCTGGTGAACTTTAGAGGACTCTTGAGT
TCTGATGAGATTTTGTTCACGCAAAGCAGTGAGACCATGGAGATGGTCAAGTTTTACGCGGAGAATGAGGAAGCCTTCTTTGAGCAGTTCGCGAAGTCGATTGTGAAGATGGGGAACATC
TCACCGTTGACGGGGACAGATGGTGAGATCAGGAGGATCTGCCGGAGGGTTAACCATGATTTTTGA

Retrieve as FASTA