Entry information : AlyPrx57
Entry ID 7542
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-12-24 (Christophe Dunand)
Peroxidase information: AlyPrx57
Name AlyPrx57
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx57
start..stop
S start..stop
AtPrx57 606 0 1..313 1..313
CagraPrx04 593 0 6..313 3..310
BrPrx57-1Aa_other 587 0 6..313 3..310
CrubPrx78 578 0 11..313 8..310
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7385710..7385916 207 N° 2 7385050..7385498 449 N° 3 7384359..7384644 286  
complement(join(7384359..7384644,7385050..7385498,7385710..7385916))


exon

Literature and cross-references AlyPrx57
DNA ref. Phytozome 12:   scaffold_6 (7385916..7384359)
Protein sequence: AlyPrx57
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313 (291)
PWM (Da):   %s   34043.58 (31584.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   10.91 (10.79) Peptide Signal:   %s   cut: 23 range:23-313
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMKGAKFSSLLVLFFIFPIAFAQLRVGFYSRSCPQAETIVRNLVRQRFGVDPTVTAALLRMHFHDCFVRGCDASLLIDSTTSEKTAGPNGSVREFDLIDRIKAQLEAACPSTVSCADIVTLATRDSVLLAGGPSYRIPTGRRDGRVSNNVDVGLPGPTISVSGAVSFFTNKGLNTFDAVALLGAHTVGQGNCGLFSDRITNFQGTGRPDPSMNPALVTSLRNTCRNSATAALDQSTPLRFDNQFFKQIRKGRGVLQVDQRLASDPQTRGIVARYANNNAFFKRQFVRAMVKMGAVDVLTGRKGEIRRNCRRFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, introns 1 and 3')
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAAGGGTGCCAAGTTTTCTTCTCTTCTTGTGCTTTTCTTTATTTTTCCAATCGCATTTGCTCAACTGAGAGTCGGGTTTTATAGCCGGTCATGCCCTCAAGCCGAGACTATCGTA
CGCAATCTGGTACGCCAACGGTTTGGTGTTGACCCAACCGTTACCGCCGCTTTGCTCCGTATGCATTTCCACGACTGTTTCGTTAGG
GTAAGGATCTAATATACCTCAACATTTTCAAAA
TACTCCATGTCAATAATTTCGATTTCTTAGATTATGTTTGTCAATAGAATATTATTAATCACAAACGCAAAAAAAATTGTAATAACATGAAATGCTCTAAAAACAATAATTATTGGTTCT
AAGCGAATTTCATATCATTTTATCTACTTAATCTTACCTTCAATATTTTTTTTTGTAGGGTTGCGACGCTTCTCTCCTTATTGATTCAACTACATCCGAGAAAACCGCTGGACCAAACGG
AAGCGTTAGGGAATTTGACCTGATCGACCGGATTAAGGCTCAGCTAGAGGCTGCATGCCCATCCACAGTCTCATGTGCTGACATCGTCACATTAGCCACACGAGACTCTGTGTTATTAGC
CGGAGGCCCGAGCTACAGAATCCCTACAGGAAGGCGCGACGGTAGAGTCTCGAACAATGTTGACGTAGGTTTACCAGGTCCAACAATCTCCGTCTCCGGAGCTGTGAGTTTCTTCACGAA
CAAAGGGTTGAACACGTTTGATGCTGTGGCGCTTTTGGGTGCACACACCGTTGGTCAGGGAAATTGTGGTCTCTTCAGTGACCGGATCACTAACTTCCAAGGAACCGGAAGACCCGACCC
GTCCATGAATCCAGCTTTGGTAACCAG
GTAATTTTAAACATGCATGGTTCAATCTTACATCCACTACCATCGAAATCATAATTAATTTGTTTCCTTGGTTTAAGAGTATAATTTTTAAAA
ATTTTAACTTCACTTTTTGGAATATTTACCATTAACCTATATATATATATATATATCGTATATTTATATATATATATATATATATATCCAATTATAAGTTTGAAAAGATGATATTTTCTA
TATTGCACAATAGTCAAAGAAAAAAAAACAGATTTTCAAATAATTAATTCCAAGATGTTTGGTTTCTTAAAACCATTAATTATTTCGGAAATATATTAGCTCCAAACCTAATCAAAATTA
TGTCCACGTTTTTATTGAGTTTTTTCATCTCATAAAAATATATTATGACTTCTTTTTTTTATGTGAATGTAGCCTAAGGAACACATGCAGAAACAGTGCGACGGCGGCACTAGACCAGTC
GACTCCATTGAGGTTTGACAACCAATTCTTCAAACAGATCCGTAAAGGAAGAGGAGTGTTGCAGGTTGACCAACGTCTCGCATCCGACCCACAAACTCGTGGGATTGTGGCTCGGTATGC
TAATAACAACGCCTTCTTCAAACGTCAGTTCGTTAGAGCAATGGTGAAGATGGGAGCCGTTGATGTGCTTACCGGTCGTAAGGGTGAGATCAGAAGGAACTGCAGGAGATTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAAGGGTGCCAAGTTTTCTTCTCTTCTTGTGCTTTTCTTTATTTTTCCAATCGCATTTGCTCAACTGAGAGTCGGGTTTTATAGCCGGTCATGCCCTCAAGCCGAGACTATCGTA
CGCAATCTGGTACGCCAACGGTTTGGTGTTGACCCAACCGTTACCGCCGCTTTGCTCCGTATGCATTTCCACGACTGTTTCGTTAGG
GGTTGCGACGCTTCTCTCCTTATTGATTCAACT
ACATCCGAGAAAACCGCTGGACCAAACGGAAGCGTTAGGGAATTTGACCTGATCGACCGGATTAAGGCTCAGCTAGAGGCTGCATGCCCATCCACAGTCTCATGTGCTGACATCGTCACA
TTAGCCACACGAGACTCTGTGTTATTAGCCGGAGGCCCGAGCTACAGAATCCCTACAGGAAGGCGCGACGGTAGAGTCTCGAACAATGTTGACGTAGGTTTACCAGGTCCAACAATCTCC
GTCTCCGGAGCTGTGAGTTTCTTCACGAACAAAGGGTTGAACACGTTTGATGCTGTGGCGCTTTTGGGTGCACACACCGTTGGTCAGGGAAATTGTGGTCTCTTCAGTGACCGGATCACT
AACTTCCAAGGAACCGGAAGACCCGACCCGTCCATGAATCCAGCTTTGGTAACCAG
CCTAAGGAACACATGCAGAAACAGTGCGACGGCGGCACTAGACCAGTCGACTCCATTGAGGTTT
GACAACCAATTCTTCAAACAGATCCGTAAAGGAAGAGGAGTGTTGCAGGTTGACCAACGTCTCGCATCCGACCCACAAACTCGTGGGATTGTGGCTCGGTATGCTAATAACAACGCCTTC
TTCAAACGTCAGTTCGTTAGAGCAATGGTGAAGATGGGAGCCGTTGATGTGCTTACCGGTCGTAAGGGTGAGATCAGAAGGAACTGCAGGAGATTCAACTGA

Retrieve as FASTA