Entry information : AlyPrx73
Entry ID 7544
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx73
Name AlyPrx73
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx73
start..stop
S start..stop
AhalPrx09 643 0 1..329 1..329
BstrPrx21 635 0 1..329 1..329
CrubPrx63 629 0 1..329 1..329
AtPrx73 629 0 1..329 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 22319689..22319904 216 N° 2 22319414..22319614 201 N° 3 22319107..22319272 166 N° 4 22318575..22318981 407
complement(join(22318575..22318981,22319107..22319272,22319414..22319614,2231968 9..22319904))


exon

Literature and cross-references AlyPrx73
DNA ref. Phytozome 12:   scaffold_8 (22319904..22318575)
Protein sequence: AlyPrx73
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   35842.66 (33241.2)  
PI (pH):   %s   10.1 (10.10) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARFGLVLVVALSITISMLPDTTTAQLKTNFYGKSCPNVEKIVKQVVNQKIKQTFVTIPATLRLFFHDCFVNGCDASVMIQSTPNNKAEKDHPDNLSLAGDGFDVVIKAKKAIDAIPSCKNKVSCADILTLATRDVVVAAGGPSYTVELGRFDGLVSTAASVNGNLPGPNFKVTELNALFAKNKLTQEDMIALSAAHTLGFAHCGKVFNRIYNFNRTHSVDPTINKAYAKELQLACPKKVDPRIAINMDPTTPRKFDNIYFKNLQQGKGLFTSDQVLFTDGRSRPTVNDWAKDPVAFNKAFVTAMTKLGRVGVKTRRNGNIRRDCGAFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGGTTTGGTCTGGTTCTAGTCGTGGCTCTTAGCATCACCATCTCTATGCTCCCGGACACAACCACTGCTCAGCTCAAAACAAATTTCTACGGGAAATCATGTCCAAATGTTGAA
AAAATCGTGAAACAAGTCGTTAACCAGAAAATCAAACAGACCTTCGTCACCATCCCAGCTACTCTCCGTCTCTTCTTCCACGATTGCTTCGTCAAT
GTAACGCTCAAACTTTTGTTGGTT
TTTTATGTTTGAAACCTATGATATGATGATTTAAATTTTTTTGTATGTAGGGATGTGATGCATCGGTCATGATTCAGTCAACGCCTAACAACAAAGCCGAGAAGGATCATCCAGACAATC
TTTCTTTGGCCGGAGATGGATTTGACGTTGTGATCAAAGCCAAGAAAGCTATTGACGCTATCCCAAGTTGCAAAAACAAAGTCTCTTGTGCTGATATTCTTACTTTAGCCACCCGAGATG
TTGTTGTCGCC
GTAAGTTATAGATTTAAATTTTTTTCCAATCATAGAAAATGTTTTTGGGAAATTCTAGGTCAAAAACACAGAACTTTATAGTTGCTATCAATACAACAATGTTAAATTT
AGTTTTTTTTTTTTTTTCTTGGATGTGTTTAGGCCGGAGGACCGTCTTACACGGTGGAGCTCGGAAGGTTTGATGGTTTGGTGTCGACTGCGGCTAGCGTTAACGGAAACTTGCCAGGAC
CAAATTTCAAAGTTACAGAACTTAACGCGCTTTTTGCGAAAAACAAACTTACCCAAGAGGACATGATCGCTCTTTCAG
GTAATGATTAAACAAGCTTTTTGCGAAAAAAAACTCGATTTG
TTTAGAAATAAAACCACTTATATATATCTCCAAAATGGATATAAATTATAATCTAAGCTATTAAAATTTTCCAAACAATGCAGCGGCTCACACACTTGGATTCGCTCATTGTGGCAAAGT
GTTCAACAGAATCTACAACTTCAACCGCACACACTCCGTTGACCCAACTATAAACAAAGCCTACGCTAAAGAACTACAGTTGGCTTGCCCCAAGAAAGTTGACCCAAGAATCGCCATCAA
CATGGACCCAACCACTCCAAGAAAGTTCGACAACATTTACTTCAAGAATCTGCAACAAGGCAAGGGACTCTTCACTTCCGACCAAGTTCTCTTTACCGATGGTCGCTCAAGGCCCACCGT
TAACGATTGGGCCAAGGACCCTGTTGCTTTCAACAAGGCTTTTGTAACCGCTATGACCAAACTCGGCCGCGTTGGTGTTAAGACTAGACGCAACGGTAACATCCGTCGTGACTGTGGCGC
CTTTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGGTTTGGTCTGGTTCTAGTCGTGGCTCTTAGCATCACCATCTCTATGCTCCCGGACACAACCACTGCTCAGCTCAAAACAAATTTCTACGGGAAATCATGTCCAAATGTTGAA
AAAATCGTGAAACAAGTCGTTAACCAGAAAATCAAACAGACCTTCGTCACCATCCCAGCTACTCTCCGTCTCTTCTTCCACGATTGCTTCGTCAAT
GGATGTGATGCATCGGTCATGATT
CAGTCAACGCCTAACAACAAAGCCGAGAAGGATCATCCAGACAATCTTTCTTTGGCCGGAGATGGATTTGACGTTGTGATCAAAGCCAAGAAAGCTATTGACGCTATCCCAAGTTGCAAA
AACAAAGTCTCTTGTGCTGATATTCTTACTTTAGCCACCCGAGATGTTGTTGTCGCC
GCCGGAGGACCGTCTTACACGGTGGAGCTCGGAAGGTTTGATGGTTTGGTGTCGACTGCGGCT
AGCGTTAACGGAAACTTGCCAGGACCAAATTTCAAAGTTACAGAACTTAACGCGCTTTTTGCGAAAAACAAACTTACCCAAGAGGACATGATCGCTCTTTCAG
CGGCTCACACACTTGGA
TTCGCTCATTGTGGCAAAGTGTTCAACAGAATCTACAACTTCAACCGCACACACTCCGTTGACCCAACTATAAACAAAGCCTACGCTAAAGAACTACAGTTGGCTTGCCCCAAGAAAGTT
GACCCAAGAATCGCCATCAACATGGACCCAACCACTCCAAGAAAGTTCGACAACATTTACTTCAAGAATCTGCAACAAGGCAAGGGACTCTTCACTTCCGACCAAGTTCTCTTTACCGAT
GGTCGCTCAAGGCCCACCGTTAACGATTGGGCCAAGGACCCTGTTGCTTTCAACAAGGCTTTTGTAACCGCTATGACCAAACTCGGCCGCGTTGGTGTTAAGACTAGACGCAACGGTAAC
ATCCGTCGTGACTGTGGCGCCTTTAACTGA

Retrieve as FASTA