Entry information : AlyPrx03
Entry ID 7545
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx03
Name AlyPrx03
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx03
start..stop
S start..stop
AhalPrx58 657 0 1..326 1..326
CagraPrx16 650 0 1..326 1..326
CbPrx01 649 0 1..326 1..326
AtPrx03 647 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1836707..1836919 213 N° 2 1837016..1837204 189 N° 3 1837292..1837454 163 N° 4 1837717..1838132 416
join(1836707..1836919,1837016..1837204,1837292..1837454,1837717..1838132)


exon

Literature and cross-references AlyPrx03
DNA ref. Phytozome 12:   scaffold_1 (1836707..1838132)
Protein sequence: AlyPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   35019.65 (32411.3) Transmb domain:   %s   i7-24o
PI (pH):   %s   8.57 (8.40) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNYLRAISLSLSFFLVGMVGPIQAQLQMNFYANSCPNAEKIVQDFVSNHISNAPSLAAALIRMHFHDCFVRGCDGSVLINSTSGNAERDATPNLTVRGFGFIDAIKAVLEAQCPGIVSCADIIALASRDAVVFTGGPNWSVPTGRRDGRISNASEALANIPPPTSNITNLQTLFANQGLDLKDLVLLSGAHTIGVSHCSSFTNRLYNFSGRGDQDPALDSAYAANLKSRKCPSLNDNKTIVEMDPGSRKTFDLSYYQLVLKRRGLFQSDSALTTNPTTLSNINRILTGSVESFFSEFAKSMEKMGRINVKTGSAGVVRRQCSVANS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTACCTGAGAGCTATATCTCTTTCACTCTCTTTCTTTCTTGTGGGAATGGTTGGACCGATCCAAGCTCAATTGCAGATGAATTTCTATGCCAATTCTTGTCCTAATGCCGAAAAG
ATTGTTCAAGATTTTGTTTCAAACCACATTTCTAATGCTCCTTCTCTTGCTGCTGCTCTCATTAGAATGCATTTCCATGACTGTTTTGTCCGA
GTAAACTCTTCTTTTCCCTCTTTTTGT
TTTCTTTATATTGTGGATCATTCTTAATCACGGATATATATATATATATATATATACATGTACATGTAGGGTTGTGATGGATCAGTGCTTATAAACTCAACGTCTGGAAACGCAGAGAGA
GACGCAACTCCTAACCTAACGGTTCGAGGGTTTGGCTTCATCGACGCAATCAAAGCCGTGCTTGAAGCTCAGTGCCCTGGAATTGTCTCTTGCGCTGATATTATCGCTCTAGCATCTCGT
GACGCTGTCGTTTTCACC
GTAAGCGAATCATATTCACGTAACATCATTGTAAAATATAAATGATAAGTATTTATCATCATAAATGTGTCTTTGCATATGTTGTAGGGAGGACCGAATTGG
AGTGTACCGACCGGGAGAAGAGATGGGAGGATATCAAACGCATCGGAGGCATTAGCCAACATTCCTCCTCCGACTAGTAATATTACTAATCTTCAGACACTCTTTGCAAACCAAGGACTT
GATCTTAAGGACCTTGTTTTACTCTCCG
GTAAAGCCTAAAACTCACTCCACACATTGCTAAGAATTAAATTATTGTGTTTTAAAAGAAAATAGTTGCGTTTAAGATTTTTATAAAACATG
TGTAAATCATAGACACAAAAAAGGACTAAAAATGATGGTTTCACAATAACCAAAAAATAATTATTATTATTGTTTCAATAAAGAAAATTAGAAAAGTATTTTTTCTTATATAGAATACAT
TTCAACCTAGTTCCAAGATATATTTAAAAGAAATAATTGTGTTAAAACAGGGGCTCACACTATCGGTGTATCTCACTGCTCGTCTTTCACAAACCGTCTCTACAATTTCAGTGGTCGTGG
AGACCAAGATCCAGCCTTAGACAGCGCATACGCAGCGAATCTCAAGTCTAGGAAATGTCCTAGCCTCAACGACAACAAGACCATCGTTGAGATGGATCCAGGGAGCCGCAAAACATTTGA
TCTTAGTTATTACCAGCTCGTTCTCAAACGTAGAGGTCTGTTTCAGTCAGACTCTGCTCTCACCACTAACCCCACAACACTCTCAAACATAAACCGGATCTTGACGGGTTCGGTGGAGAG
TTTCTTCTCTGAGTTTGCCAAGTCGATGGAGAAAATGGGTCGGATCAATGTCAAGACTGGTTCAGCTGGAGTGGTTAGGAGGCAATGTTCCGTTGCAAATAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTACCTGAGAGCTATATCTCTTTCACTCTCTTTCTTTCTTGTGGGAATGGTTGGACCGATCCAAGCTCAATTGCAGATGAATTTCTATGCCAATTCTTGTCCTAATGCCGAAAAG
ATTGTTCAAGATTTTGTTTCAAACCACATTTCTAATGCTCCTTCTCTTGCTGCTGCTCTCATTAGAATGCATTTCCATGACTGTTTTGTCCGA
GGTTGTGATGGATCAGTGCTTATAAAC
TCAACGTCTGGAAACGCAGAGAGAGACGCAACTCCTAACCTAACGGTTCGAGGGTTTGGCTTCATCGACGCAATCAAAGCCGTGCTTGAAGCTCAGTGCCCTGGAATTGTCTCTTGCGCT
GATATTATCGCTCTAGCATCTCGTGACGCTGTCGTTTTCACC
GGAGGACCGAATTGGAGTGTACCGACCGGGAGAAGAGATGGGAGGATATCAAACGCATCGGAGGCATTAGCCAACATT
CCTCCTCCGACTAGTAATATTACTAATCTTCAGACACTCTTTGCAAACCAAGGACTTGATCTTAAGGACCTTGTTTTACTCTCCG
GGGCTCACACTATCGGTGTATCTCACTGCTCGTCT
TTCACAAACCGTCTCTACAATTTCAGTGGTCGTGGAGACCAAGATCCAGCCTTAGACAGCGCATACGCAGCGAATCTCAAGTCTAGGAAATGTCCTAGCCTCAACGACAACAAGACCATC
GTTGAGATGGATCCAGGGAGCCGCAAAACATTTGATCTTAGTTATTACCAGCTCGTTCTCAAACGTAGAGGTCTGTTTCAGTCAGACTCTGCTCTCACCACTAACCCCACAACACTCTCA
AACATAAACCGGATCTTGACGGGTTCGGTGGAGAGTTTCTTCTCTGAGTTTGCCAAGTCGATGGAGAAAATGGGTCGGATCAATGTCAAGACTGGTTCAGCTGGAGTGGTTAGGAGGCAA
TGTTCCGTTGCAAATAGTTAA

Retrieve as FASTA