Entry information : AlyPrx28
Entry ID 7546
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-12-24 (Christophe Dunand)
Peroxidase information: AlyPrx28
Name AlyPrx28
Class Class III peroxidase    [Orthogroup: Prx130]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx28
start..stop
S start..stop
AtPrx28 599 0 1..321 1..321
CrubPrx37 533 0 1..321 1..322
BrPrx28-1Aa_other 530 0 1..321 1..323
BstrPrx48 519 0 1..321 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1170424..1170627 204 N° 2 1169656..1170119 464 N° 3 1169278..1169575 298  
complement(join(1169278..1169575,1169656..1170119,1170424..1170627))


exon

Literature and cross-references AlyPrx28
DNA ref. Phytozome 12:   scaffold_3 (1170627..1169278)
Protein sequence: AlyPrx28
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (300)
PWM (Da):   %s   34443.51 (32115.1) Transmb domain:   %s   i7-26o
PI (pH):   %s   5.78 (5.12) Peptide Signal:   %s   cut: 22 range:22-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKIAKFSVLLLILFIFPVALAQLKFGFYKESCPDAETIVQNLVRQRFGSDPTITAALTRMHFHDCFVQGCDASLLIDQTTSQSSEKTAGPNGSVRGFELIDEIKTALEAQCPSKVSCSDIVTLATRDSVFLGGGPNYTVPTGRRDGFVSNPEDANRILPPPFISVEGLLSFFGNKGMNVFDAVALLGAHTVGVASCGNFIDRATNFQGTGLPDPSMDPFLAGRLRDTCAVPGGFAALDQSMPVRPVSFDNLFFGQIRERKGILLIDQLIATDPATSGVVFQYAANNELFKRQFAIAMVKMGALDVLTGSAGEIRTNCRAFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, introns 1 and 3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATTGCAAAGTTTTCTGTTCTACTCTTGATTTTATTTATTTTCCCCGTGGCATTAGCGCAGCTAAAATTCGGGTTTTACAAAGAATCGTGCCCTGATGCAGAGACAATCGTACAA
AACCTGGTCCGCCAGCGTTTTGGTAGTGATCCTACAATCACTGCCGCCTTGACTCGGATGCATTTTCATGACTGTTTTGTCCAG
GTATGAATCTCATCAAACATCAGCTTTAATTTTAGT
ATCATCTTTAATTTTAGTATCATTAGTTATTTTGTGTTTGTTTGTTATTGGCTTAAGTATCGTTAGGTTTATTAGAAGAGATGCAATCAAAGAGAACTATGTAAGAAATTATTCAATCGA
GTTAAAAACAAAAAACCAGCAAAACTATATATAATTTTCTGAAAATTAAATCTTGTCTTTATTTATTTTTTTATCCTCTTTACTTGAATATTATTAAATATATGCAACGGTTTTTTAAAA
GACAATATCTCGTTGACATTTCTCATAGGGCTGCGACGCTTCTCTCCTCATAGACCAAACGACGTCTCAATCATCGGAAAAAACCGCCGGCCCAAACGGTAGCGTGAGAGGGTTCGAGCT
GATCGACGAGATCAAGACGGCACTCGAAGCTCAATGTCCCTCCAAGGTCTCGTGCTCCGACATAGTCACGCTCGCCACACGTGACTCCGTGTTCTTAGGCGGAGGGCCTAACTACACGGT
CCCCACCGGACGTCGTGATGGCTTTGTGTCGAACCCTGAAGACGCCAATAGGATCCTCCCTCCACCATTCATCTCCGTCGAAGGTCTGTTAAGTTTCTTCGGCAACAAAGGAATGAATGT
TTTTGATGCCGTAGCTCTTTTGGGGGCGCACACGGTTGGGGTCGCTTCTTGTGGTAATTTTATTGACCGGGCCACCAACTTTCAAGGAACCGGACTACCCGACCCATCCATGGACCCCTT
TTTGGCTGGCAG
GTAATTGAAATCGAGTTTAGCCGTGTTTACGTGATTAACTACTATAGATATGTGTTATATAGTTAATATCTCTCATATAGGCTAAGGGACACATGTGCGGTTCCAGGC
GGCTTCGCGGCACTGGACCAGTCGATGCCAGTAAGGCCGGTCTCATTCGACAACTTGTTCTTTGGTCAGATCAGAGAGAGGAAAGGAATTTTGTTAATCGACCAACTAATCGCGACCGAC
CCGGCCACTTCTGGTGTTGTGTTTCAGTACGCGGCCAACAATGAACTATTCAAACGTCAGTTCGCAATCGCGATGGTGAAGATGGGAGCCCTTGACGTGCTTACCGGTTCAGCTGGTGAG
ATCAGGACGAATTGTAGAGCATTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATTGCAAAGTTTTCTGTTCTACTCTTGATTTTATTTATTTTCCCCGTGGCATTAGCGCAGCTAAAATTCGGGTTTTACAAAGAATCGTGCCCTGATGCAGAGACAATCGTACAA
AACCTGGTCCGCCAGCGTTTTGGTAGTGATCCTACAATCACTGCCGCCTTGACTCGGATGCATTTTCATGACTGTTTTGTCCAG
GGCTGCGACGCTTCTCTCCTCATAGACCAAACGACG
TCTCAATCATCGGAAAAAACCGCCGGCCCAAACGGTAGCGTGAGAGGGTTCGAGCTGATCGACGAGATCAAGACGGCACTCGAAGCTCAATGTCCCTCCAAGGTCTCGTGCTCCGACATA
GTCACGCTCGCCACACGTGACTCCGTGTTCTTAGGCGGAGGGCCTAACTACACGGTCCCCACCGGACGTCGTGATGGCTTTGTGTCGAACCCTGAAGACGCCAATAGGATCCTCCCTCCA
CCATTCATCTCCGTCGAAGGTCTGTTAAGTTTCTTCGGCAACAAAGGAATGAATGTTTTTGATGCCGTAGCTCTTTTGGGGGCGCACACGGTTGGGGTCGCTTCTTGTGGTAATTTTATT
GACCGGGCCACCAACTTTCAAGGAACCGGACTACCCGACCCATCCATGGACCCCTTTTTGGCTGGCAG
GCTAAGGGACACATGTGCGGTTCCAGGCGGCTTCGCGGCACTGGACCAGTCG
ATGCCAGTAAGGCCGGTCTCATTCGACAACTTGTTCTTTGGTCAGATCAGAGAGAGGAAAGGAATTTTGTTAATCGACCAACTAATCGCGACCGACCCGGCCACTTCTGGTGTTGTGTTT
CAGTACGCGGCCAACAATGAACTATTCAAACGTCAGTTCGCAATCGCGATGGTGAAGATGGGAGCCCTTGACGTGCTTACCGGTTCAGCTGGTGAGATCAGGACGAATTGTAGAGCATTC
AACTAA

Retrieve as FASTA