Entry information : AlyPrx46
Entry ID 7548
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx46
Name AlyPrx46
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx46
start..stop
S start..stop
AtPrx46 623 0 1..326 1..326
AhalPrx48 602 0 1..326 1..326
TsPrx46 573 0 3..326 6..330
BstrPrx22 571 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4194482..4194703 222 N° 2 4194776..4194955 180 N° 3 4195163..4195328 166 N° 4 4195544..4195956 413
join(4194482..4194703,4194776..4194955,4195163..4195328,4195544..4195956)


exon

Literature and cross-references AlyPrx46
DNA ref. Phytozome 12:   scaffold_7 (4194482..4195956)
Protein sequence: AlyPrx46
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (299)
PWM (Da):   %s   35144.14 (32203.6) Transmb domain:   %s   i12-34o
PI (pH):   %s   4.55 (4.43) Peptide Signal:   %s   cut: 28 range:28-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSYKLNYSSILHLLLFLSSLLTSSANLSFNFYAGSCSVAEFLVRNTVRSATSSDPTIPGKLVRLLFHDCFVQGCDASVLIQGNGTERSDPGNASLGGFSVIDTAKNAIEILCPDTVSCADIVALAARDAVEAAGGPVVKIPTGRRDGKESMAANVRPNIIDTDFTLDQMIDAFSSKGLSIQDLVVLSGAHTIGASHCNAFNGRFQRDSKGNFELIDASLDNSYAETLMNKCSSSESSSLTVSNDPETSSIFDNQYYRNLETHKGLFQTDSALMEDNRTRTMVEELASDEESFYQRWSESFVRLSMVGVKVGEDGEIRRSCSSIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCTCTTACAAACTAAACTATTCCTCTATTCTTCATCTCCTTCTGTTTCTTTCTAGTCTTCTCACTTCCTCCGCCAACCTCTCATTTAATTTCTACGCCGGTTCTTGTTCTGTA
GCCGAGTTTCTAGTCAGAAACACCGTTAGATCAGCTACCTCCTCCGATCCAACGATCCCGGGGAAACTCGTCCGTCTCCTCTTCCACGACTGTTTCGTCCAG
GTAAGACACACTCATTAC
GAATTACAAAGGAAAGTGAAACAATTTGGCTTGAGATTTGTTTGTTGTTGCAAGGGTTGTGATGCGTCAGTGTTGATACAAGGGAATGGCACAGAGAGAAGTGATCCCGGAAATGCCTCT
CTTGGAGGATTCTCAGTCATAGACACAGCCAAGAACGCCATCGAGATTTTATGTCCGGACACTGTTTCCTGCGCTGACATAGTCGCACTTGCTGCTAGAGACGCCGTCGAAGCT
GTAACA
TTCACTTTACTTCAATCTACTGTATATTGCTCTAATCCGGTTTAACCAATCCCAACTGAACCGAAAGCATGAAATCGACAAAAAAACATATAAACCTATTCTGTATCATTTTCTAATAGA
AAAGAAAATAACCGGACTTGGAGATACATAAAACCGGTTATCCTTCTTAAGGTTTGAATGTTTTCTTTTTTGGCGGGACAGGCAGGAGGACCGGTGGTTAAGATTCCGACAGGGAGGAGA
GACGGGAAAGAATCGATGGCTGCAAACGTAAGACCGAACATCATCGACACAGATTTCACTCTCGATCAAATGATCGATGCCTTCTCTTCTAAAGGCTTGTCCATTCAAGATCTCGTTGTC
CTCTCTG
GTATCAAACTATCAATCAATGTTTCTAAACGCTTTTTATCAATTTCCCCAAAATGTTTTGCTAAACTCTAACAGAGTATGAAACAGAGTTTGCTTCAAGCCTACACGAATTGA
CTAAGCCGGATTGGTCATTCAATTTACTCTTTGGTTAAGTCAATTCTTGTTGTAGCAAACTCTGTTAAACTCCTCAGATTCTTCTTTTATACTTGCATTTAGGAGCACACACGATTGGAG
CATCACACTGTAACGCATTCAATGGAAGGTTTCAACGAGACTCGAAAGGAAACTTCGAGCTAATCGACGCGTCTCTCGACAACTCCTACGCAGAGACACTAATGAACAAATGTTCGTCCT
CGGAATCCTCGTCATTGACAGTGAGCAACGATCCAGAGACATCTTCCATATTCGATAATCAGTACTATAGGAATCTGGAGACTCACAAGGGTTTGTTCCAGACGGATTCTGCTTTGATGG
AGGATAATCGGACGAGGACGATGGTGGAGGAATTAGCGAGTGATGAGGAAAGTTTTTATCAGAGATGGAGTGAGTCGTTTGTGAGACTGAGTATGGTTGGTGTGAAAGTTGGTGAAGATG
GTGAGATAAGACGTTCTTGTTCTTCCATTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCTCTTACAAACTAAACTATTCCTCTATTCTTCATCTCCTTCTGTTTCTTTCTAGTCTTCTCACTTCCTCCGCCAACCTCTCATTTAATTTCTACGCCGGTTCTTGTTCTGTA
GCCGAGTTTCTAGTCAGAAACACCGTTAGATCAGCTACCTCCTCCGATCCAACGATCCCGGGGAAACTCGTCCGTCTCCTCTTCCACGACTGTTTCGTCCAG
GGTTGTGATGCGTCAGTG
TTGATACAAGGGAATGGCACAGAGAGAAGTGATCCCGGAAATGCCTCTCTTGGAGGATTCTCAGTCATAGACACAGCCAAGAACGCCATCGAGATTTTATGTCCGGACACTGTTTCCTGC
GCTGACATAGTCGCACTTGCTGCTAGAGACGCCGTCGAAGCT
GCAGGAGGACCGGTGGTTAAGATTCCGACAGGGAGGAGAGACGGGAAAGAATCGATGGCTGCAAACGTAAGACCGAAC
ATCATCGACACAGATTTCACTCTCGATCAAATGATCGATGCCTTCTCTTCTAAAGGCTTGTCCATTCAAGATCTCGTTGTCCTCTCTG
GAGCACACACGATTGGAGCATCACACTGTAAC
GCATTCAATGGAAGGTTTCAACGAGACTCGAAAGGAAACTTCGAGCTAATCGACGCGTCTCTCGACAACTCCTACGCAGAGACACTAATGAACAAATGTTCGTCCTCGGAATCCTCGTCA
TTGACAGTGAGCAACGATCCAGAGACATCTTCCATATTCGATAATCAGTACTATAGGAATCTGGAGACTCACAAGGGTTTGTTCCAGACGGATTCTGCTTTGATGGAGGATAATCGGACG
AGGACGATGGTGGAGGAATTAGCGAGTGATGAGGAAAGTTTTTATCAGAGATGGAGTGAGTCGTTTGTGAGACTGAGTATGGTTGGTGTGAAAGTTGGTGAAGATGGTGAGATAAGACGT
TCTTGTTCTTCCATTAATTGA

Retrieve as FASTA