Entry information : AlyPrx09
Entry ID 7552
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx09
Name AlyPrx09
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx09
start..stop
S start..stop
AhalPrx34 705 0 1..346 1..346
09 677 0 1..346 1..346
BstrPrx25 652 0 1..346 21..366
BrPrx09-1Aa_other 650 0 1..346 1..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 22949370..22949639 270 N° 2 22949718..22949909 192 N° 3 22949997..22950162 166 N° 4 22950279..22950691 413
join(22949370..22949639,22949718..22949909,22949997..22950162,22950279..22950691 )


exon

Literature and cross-references AlyPrx09
DNA ref. Phytozome 12:   scaffold_1 (22949370..22950691)
Protein sequence: AlyPrx09
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (323)
PWM (Da):   %s   37545 (35111.6)  
PI (pH):   %s   7.06 (7.06) Peptide Signal:   %s   cut: 24 range:24-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAISKLIPTLVLFALFSFDVGVAHPGLGFGWGSNNPIGGSFSSNLYPQFYQFSCPQADEIVMTVLEKAIAKEPRMAASLLRLHFHDCFVQGCDASILLDDSATIRSEKNAGPNKNSIRGFQVIDEIKAKLEQACPQTVSCADILALAARGSTILSGGPSWELPLGRRDSRTASLNGANTNIPAPNSTIQNLLTLFQRQGLNEEDLVSLSGGHTIGVARCTTFKQRLYNQNGNNQPDETLERSYYYGLRSICPPTGGDNNISPLDLASPSRFDNTYFKLLLWGKGLLTSDEVLLTGNVGRTGALVKAYAEDERLFFHQFAKSMVNMGNIQPLTGFNGEIRKSCHVIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCTCAAAGCTTATTCCTACTCTTGTGCTCTTTGCTTTGTTCTCTTTTGATGTTGGTGTTGCTCATCCAGGTCTAGGATTTGGATGGGGAAGTAATAATCCCATTGGAGGATCT
TTTTCTTCAAATCTTTACCCACAGTTTTACCAGTTCTCTTGCCCACAAGCTGATGAGATTGTCATGACGGTGCTCGAAAAAGCCATAGCTAAAGAACCAAGAATGGCAGCATCTTTACTC
AGGCTTCACTTCCACGACTGCTTCGTTCAG
GTAAAATCTTACCTATTTTTGTTTCCCTTTTATGTTTCTCATAAGCTTAATACTTAAACACTCTGTTGTGTAAAACAGGGCTGTGATGCA
TCAATCTTGTTGGATGATAGTGCTACAATAAGAAGTGAAAAGAATGCGGGACCAAACAAGAACTCTATTAGAGGGTTTCAAGTAATCGACGAGATCAAAGCCAAACTTGAGCAAGCTTGC
CCTCAAACTGTCTCCTGCGCCGACATTCTAGCTCTTGCTGCTCGTGGCTCAACTATACTG
GTAAATTTAAGAGACTTTCAAAGAGAAACTATTGGCTCACTTACAAGTTATATAGCTTAT
ATTTTCTGACTTTGTGGTTCAATACAGAGCGGTGGACCATCATGGGAGCTTCCACTAGGGAGGAGAGACTCGAGGACAGCGAGCCTTAATGGCGCAAACACAAACATTCCTGCACCTAAC
TCCACTATTCAGAATCTCTTAACCTTGTTCCAACGCCAAGGTTTGAACGAAGAAGACCTTGTTTCCCTATCAG
GTGATCTTAATAACATTATTTTTCTTTTGTCATAGTGGTTGACATGG
AAACCAAACCGAAACCGAATGATAACAATATTTTTTTGTACTGATCAAAACCGAACCAAAATTTTGCAGGGGGACATACGATTGGAGTAGCGAGGTGCACAACGTTCAAACAAAGGCTAT
ACAATCAAAACGGTAACAACCAACCAGACGAGACGCTAGAGAGGTCTTACTACTATGGTCTCAGGTCGATTTGTCCACCAACGGGCGGTGACAACAACATTTCACCTCTAGACTTAGCCT
CTCCTTCTCGATTCGACAACACATACTTCAAGCTCCTTCTATGGGGAAAAGGCTTATTGACTTCAGATGAAGTGCTTCTCACTGGCAACGTAGGCAGGACTGGTGCACTAGTGAAAGCTT
ACGCAGAAGACGAGAGACTTTTCTTCCACCAATTTGCGAAGTCGATGGTAAACATGGGGAACATTCAGCCTCTTACTGGTTTTAATGGTGAGATCAGGAAGAGTTGTCATGTGATTAACT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCTCAAAGCTTATTCCTACTCTTGTGCTCTTTGCTTTGTTCTCTTTTGATGTTGGTGTTGCTCATCCAGGTCTAGGATTTGGATGGGGAAGTAATAATCCCATTGGAGGATCT
TTTTCTTCAAATCTTTACCCACAGTTTTACCAGTTCTCTTGCCCACAAGCTGATGAGATTGTCATGACGGTGCTCGAAAAAGCCATAGCTAAAGAACCAAGAATGGCAGCATCTTTACTC
AGGCTTCACTTCCACGACTGCTTCGTTCAG
GGCTGTGATGCATCAATCTTGTTGGATGATAGTGCTACAATAAGAAGTGAAAAGAATGCGGGACCAAACAAGAACTCTATTAGAGGGTTT
CAAGTAATCGACGAGATCAAAGCCAAACTTGAGCAAGCTTGCCCTCAAACTGTCTCCTGCGCCGACATTCTAGCTCTTGCTGCTCGTGGCTCAACTATACTG
AGCGGTGGACCATCATGG
GAGCTTCCACTAGGGAGGAGAGACTCGAGGACAGCGAGCCTTAATGGCGCAAACACAAACATTCCTGCACCTAACTCCACTATTCAGAATCTCTTAACCTTGTTCCAACGCCAAGGTTTG
AACGAAGAAGACCTTGTTTCCCTATCAG
GGGGACATACGATTGGAGTAGCGAGGTGCACAACGTTCAAACAAAGGCTATACAATCAAAACGGTAACAACCAACCAGACGAGACGCTAGAG
AGGTCTTACTACTATGGTCTCAGGTCGATTTGTCCACCAACGGGCGGTGACAACAACATTTCACCTCTAGACTTAGCCTCTCCTTCTCGATTCGACAACACATACTTCAAGCTCCTTCTA
TGGGGAAAAGGCTTATTGACTTCAGATGAAGTGCTTCTCACTGGCAACGTAGGCAGGACTGGTGCACTAGTGAAAGCTTACGCAGAAGACGAGAGACTTTTCTTCCACCAATTTGCGAAG
TCGATGGTAAACATGGGGAACATTCAGCCTCTTACTGGTTTTAATGGTGAGATCAGGAAGAGTTGTCATGTGATTAACTAA

Retrieve as FASTA