Entry information : AlyPrx13
Entry ID 7553
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx13
Name AlyPrx13
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx13
start..stop
S start..stop
AhalPrx56 677 0 1..336 1..336
BstrPrx54 665 0 1..336 1..336
AtPrx13 654 0 1..336 1..336
CagraPrx60 640 0 1..336 1..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17495412..17495669 258 N° 2 17495135..17495320 186 N° 3 17494662..17494827 166 N° 4 17494166..17494566 401
complement(join(17494166..17494566,17494662..17494827,17495135..17495320,1749541 2..17495669))


exon

Literature and cross-references AlyPrx13
DNA ref. Phytozome 12:   scaffold_2 (17495669..17494166)
Protein sequence: AlyPrx13
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336
PWM (Da):   %s   36648.62 Transmb domain:   %s   i9-31o
PI (pH):   %s   4.96
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRRIREDISISLFGPKMITVALFLVLFYFHDQLGYSVAQLQFGFYSETCPSAESIVRDVVQHAVTNDPGKAAVLLRLQFHDCFVEGCDGSILIKHDGNDDERFAAGNAGVAGFDVIDEAKSELERLCPGIVSCADIVALAARDAIAEVKGPFYEVPTGRRDGRIANVGHATNLPDVQDSINTLKSKFREKGLSDQDLVLLSAGAHTIGTTACFFVIPRLDAQDPTINPEFFQILRSKCPQGGDVNVRIPLDWDSQFVFDDQILQNIKNGRGVILSDSVLYQDNSMKKIIDSYLETNQSSKANFAADFVKAMVKMGAIGVKIGVEGEIRRLCSATN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTCGTAGAATACGAGAAGATATATCGATTAGTTTGTTTGGTCCGAAAATGATCACTGTTGCATTATTTCTAGTTTTGTTTTATTTTCATGATCAGTTAGGTTATTCGGTGGCACAA
CTTCAGTTTGGATTCTACTCAGAAACATGTCCATCAGCAGAATCAATCGTTCGTGATGTTGTTCAACATGCGGTGACCAACGACCCCGGAAAGGCTGCTGTCTTACTCCGTCTCCAGTTC
CACGATTGCTTCGTTGAG
GTCCATTAATGCAAAAAAAAGAGAAGAGAACCAATTAATAATCATTTTTTATACTAGTCATGACATAAATTGGTTTGGTTATATGTCGTAGGGTTGTGATGG
GTCAATACTAATCAAGCATGATGGGAACGATGACGAAAGGTTTGCTGCGGGTAACGCGGGTGTGGCTGGTTTCGATGTTATAGACGAAGCCAAATCAGAGCTTGAACGTCTTTGTCCGGG
GATTGTGTCTTGCGCCGACATCGTTGCTCTTGCTGCTAGAGACGCTATTGCTGAG
GTAACACTTGAATAGTTTTTTTTTTCAATTTTTTTTTATACTAAAAGGTTCTAGGCCGAGGTCCA
TACATTTTTCAAACTTGGACCAACCTTTAATATTTTTACTGTACTACCTGCCATTCCATCCTGTAACTTCTTAAAATTTTCTAGGATATATACTTCTTTTTCTTTTTTTTTTTTATCATA
CTTTAATATATAGTTCTTTTTTAATACACAATGAATAGTTTATTGTATTCATATATAGGGCTAAAGAAGATCATTTTTCTTTTATAAAGTCTATCATTTGATGTTAAATATTAACTGATT
AGGTAAAAGGACCATTTTATGAGGTTCCAACCGGTCGGAGAGACGGTCGGATTGCAAATGTTGGTCATGCTACAAACTTGCCAGATGTTCAAGATTCCATAAACACTTTGAAATCAAAAT
TTAGAGAAAAAGGGCTTTCAGATCAAGATCTTGTACTTCTTAGTGCTG
GTATTTATCATAATCTTGATAACTTGATATATAAACACTATTTCGGGAAAAAAGAAAACACTATCTTGCTTA
CTCGAGTTTTATTTTTGTTAAAGGTGCACATACTATTGGTACAACCGCTTGCTTCTTCGTCATACCACGTTTAGATGCTCAAGATCCTACCATAAATCCAGAATTCTTTCAAATCCTAAG
GTCAAAATGTCCCCAAGGCGGAGATGTTAATGTCAGGATTCCGTTGGACTGGGATAGCCAGTTTGTGTTTGATGACCAAATCTTGCAAAACATCAAAAATGGCAGAGGTGTCATTCTATC
GGACTCTGTCTTGTACCAAGACAATAGTATGAAAAAAATCATTGATTCGTACCTAGAAACTAATCAAAGTTCAAAGGCTAATTTTGCTGCGGATTTTGTTAAAGCCATGGTAAAGATGGG
TGCTATCGGAGTGAAAATCGGTGTTGAAGGAGAGATTAGACGTTTATGCAGTGCTACAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTCGTAGAATACGAGAAGATATATCGATTAGTTTGTTTGGTCCGAAAATGATCACTGTTGCATTATTTCTAGTTTTGTTTTATTTTCATGATCAGTTAGGTTATTCGGTGGCACAA
CTTCAGTTTGGATTCTACTCAGAAACATGTCCATCAGCAGAATCAATCGTTCGTGATGTTGTTCAACATGCGGTGACCAACGACCCCGGAAAGGCTGCTGTCTTACTCCGTCTCCAGTTC
CACGATTGCTTCGTTGAG
GGTTGTGATGGGTCAATACTAATCAAGCATGATGGGAACGATGACGAAAGGTTTGCTGCGGGTAACGCGGGTGTGGCTGGTTTCGATGTTATAGACGAAGCC
AAATCAGAGCTTGAACGTCTTTGTCCGGGGATTGTGTCTTGCGCCGACATCGTTGCTCTTGCTGCTAGAGACGCTATTGCTGAG
GTAAAAGGACCATTTTATGAGGTTCCAACCGGTCGG
AGAGACGGTCGGATTGCAAATGTTGGTCATGCTACAAACTTGCCAGATGTTCAAGATTCCATAAACACTTTGAAATCAAAATTTAGAGAAAAAGGGCTTTCAGATCAAGATCTTGTACTT
CTTAGTGCTG
GTGCACATACTATTGGTACAACCGCTTGCTTCTTCGTCATACCACGTTTAGATGCTCAAGATCCTACCATAAATCCAGAATTCTTTCAAATCCTAAGGTCAAAATGTCCC
CAAGGCGGAGATGTTAATGTCAGGATTCCGTTGGACTGGGATAGCCAGTTTGTGTTTGATGACCAAATCTTGCAAAACATCAAAAATGGCAGAGGTGTCATTCTATCGGACTCTGTCTTG
TACCAAGACAATAGTATGAAAAAAATCATTGATTCGTACCTAGAAACTAATCAAAGTTCAAAGGCTAATTTTGCTGCGGATTTTGTTAAAGCCATGGTAAAGATGGGTGCTATCGGAGTG
AAAATCGGTGTTGAAGGAGAGATTAGACGTTTATGCAGTGCTACAAACTAG

Retrieve as FASTA