Entry information : AlyPrx47
Entry ID 7554
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx47
Name AlyPrx47
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx47
start..stop
S start..stop
AtPrx47 667 0 1..325 1..325
CrubPrx54 648 0 1..325 1..325
CagraPrx66 644 0 1..325 1..325
BstrPrx62 640 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3274136..3274381 246 N° 2 3273837..3274025 189 N° 3 3273577..3273739 163 N° 4 3272794..3273173 380
complement(join(3272794..3273173,3273577..3273739,3273837..3274025,3274136..3274 381))


exon

Literature and cross-references AlyPrx47
DNA ref. Phytozome 12:   scaffold_7 (3274381..3272794)
Protein sequence: AlyPrx47
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325
PWM (Da):   %s   35750.73 Transmb domain:   %s   i12-34o
PI (pH):   %s   8.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLTRFKIQNNKMVGANLVSMILLMHAIVGFPFHARGLSMTYYMMSCPFAEQIVKNSVNNALQADPTLAAGLIRMLFHDCFIEGCDASILLDSTKDNTAEKDSPANLSLRGYEIIDDAKQKIENRCPGVVSCADIVAMAARDAVFWAGGPYYDIPKGRFDGKRSKIEDTRNLPSPFLNASQLIQTFGQRGFTPQDVVALSGAHTLGVARCSSFKARLTVPDSSLDSTFANTLSKTCSAGDNAEQPFDATRNDFDNAYFNALQMKSGVLFSDQTLFNTPRTRNLVNGYALNQAKFFFDFQQAMRKMSNLDVKLGSQGEIRQNCRSIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGACAAGATTTAAGATACAAAACAATAAGATGGTTGGGGCAAATTTAGTGAGCATGATTCTGTTGATGCATGCCATTGTTGGGTTTCCTTTTCATGCGAGGGGCTTAAGTATGACT
TACTACATGATGAGCTGTCCTTTCGCCGAACAGATTGTGAAGAACAGTGTTAACAATGCTCTTCAAGCCGATCCCACTTTAGCCGCTGGTCTTATCCGTATGTTGTTCCATGACTGTTTC
ATAGAG
GTGCGTAACGTTTTCTCTGTTTCATTGATTTTAAGTTCTAATTAATGGTGTCTTTTACGTAGAAATCCCCTAAAATTAGTTTTTTTTTTTTTCTTTCTTTCTATACTAAGGGAT
GTGACGCGTCGATTCTTCTAGATTCTACAAAAGACAACACTGCGGAAAAGGATTCTCCTGCGAATCTGAGTCTACGTGGCTACGAGATTATCGATGATGCAAAACAGAAAATCGAGAATA
GATGTCCAGGAGTTGTATCTTGCGCTGATATTGTTGCCATGGCTGCTAGAGATGCTGTCTTTTGG
GTAATTAATTAAGCTGATCAAGATTTTGAATCTTCTGTAATTATATGAAAGATGA
TTAATTTGTGTATTTAATCTAATGAGTAATTGAAATTGTTAGGCTGGTGGTCCATATTATGATATACCAAAAGGAAGGTTTGATGGTAAAAGATCGAAAATCGAAGATACAAGAAATCTA
CCTTCACCTTTTCTCAATGCCTCTCAACTAATTCAAACTTTTGGCCAACGTGGTTTCACTCCACAAGATGTTGTTGCTCTCTCTG
GTGAGTCTTTGCAATACTCTTGCATTCTATATATA
TGTGTGTGTATTATTGTGTGTAATAAATCTCTATATATCCACTAGGTATTACCTCTATAAAGGAAAAAAAAAATGGTAAAAAAAAATTATAACTGTTTAATTGGTTTCAAAGTTTTTTTC
TTGCTATTTTTTTTTTTCACTTAATTTACTTCATCGGCCCCATTATCAGTAGTTCTGGAGAATAAATTTGTTTCATTTTTCTCTTTTCTTCTTTAGCAATAAAATATTTTATTAGTTTCT
ATAATACTATAAAATCAGATAATTGATTCACATCACTTGGAATGAAATCCATGTAATATGTTTATCAAGACAGTGAATGCTCCACATTCTAATTTGGTTTTAACTTAATAATTTGTGGGG
ATATATAGGAGCACATACCCTAGGAGTTGCACGATGCTCCTCCTTCAAGGCTAGACTTACCGTCCCAGACTCTTCATTAGACTCGACTTTTGCAAACACTCTCTCTAAAACTTGCAGCGC
GGGTGACAATGCAGAGCAACCCTTTGATGCTACGCGCAACGATTTCGACAATGCTTACTTCAATGCGCTTCAGATGAAATCAGGAGTCCTCTTTTCGGACCAAACCTTATTCAACACACC
AAGGACCAGGAATCTTGTTAATGGCTATGCCCTTAACCAAGCGAAGTTCTTCTTTGATTTCCAACAGGCCATGCGCAAGATGAGCAATCTTGACGTTAAACTTGGCTCTCAAGGTGAAAT
TCGTCAAAATTGTCGGAGTATTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGACAAGATTTAAGATACAAAACAATAAGATGGTTGGGGCAAATTTAGTGAGCATGATTCTGTTGATGCATGCCATTGTTGGGTTTCCTTTTCATGCGAGGGGCTTAAGTATGACT
TACTACATGATGAGCTGTCCTTTCGCCGAACAGATTGTGAAGAACAGTGTTAACAATGCTCTTCAAGCCGATCCCACTTTAGCCGCTGGTCTTATCCGTATGTTGTTCCATGACTGTTTC
ATAGAG
GGATGTGACGCGTCGATTCTTCTAGATTCTACAAAAGACAACACTGCGGAAAAGGATTCTCCTGCGAATCTGAGTCTACGTGGCTACGAGATTATCGATGATGCAAAACAGAAA
ATCGAGAATAGATGTCCAGGAGTTGTATCTTGCGCTGATATTGTTGCCATGGCTGCTAGAGATGCTGTCTTTTGG
GCTGGTGGTCCATATTATGATATACCAAAAGGAAGGTTTGATGGT
AAAAGATCGAAAATCGAAGATACAAGAAATCTACCTTCACCTTTTCTCAATGCCTCTCAACTAATTCAAACTTTTGGCCAACGTGGTTTCACTCCACAAGATGTTGTTGCTCTCTCTG
GA
GCACATACCCTAGGAGTTGCACGATGCTCCTCCTTCAAGGCTAGACTTACCGTCCCAGACTCTTCATTAGACTCGACTTTTGCAAACACTCTCTCTAAAACTTGCAGCGCGGGTGACAAT
GCAGAGCAACCCTTTGATGCTACGCGCAACGATTTCGACAATGCTTACTTCAATGCGCTTCAGATGAAATCAGGAGTCCTCTTTTCGGACCAAACCTTATTCAACACACCAAGGACCAGG
AATCTTGTTAATGGCTATGCCCTTAACCAAGCGAAGTTCTTCTTTGATTTCCAACAGGCCATGCGCAAGATGAGCAATCTTGACGTTAAACTTGGCTCTCAAGGTGAAATTCGTCAAAAT
TGTCGGAGTATTAATTAG

Retrieve as FASTA