Entry information : AlyPrx24
Entry ID 7557
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx24
Name AlyPrx24
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx24
start..stop
S start..stop
CagraPrx53 652 0 1..346 1..348
CrubPrx91 650 0 1..346 1..348
BstrPrx84 642 0 1..346 1..348
AtPrx24 634 0 3..346 4..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18949063..18949323 261 N° 2 18948766..18948960 195 N° 3 18948440..18948605 166 N° 4 18947639..18948057 419
complement(join(18947639..18948057,18948440..18948605,18948766..18948960,1894906 3..18949323))


exon

Literature and cross-references AlyPrx24
DNA ref. Phytozome 12:   scaffold_4 (18949323..18947639)
Protein sequence: AlyPrx24
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (323)
PWM (Da):   %s   37756.57 (35152.1)  
PI (pH):   %s   9.12 (9.27) Peptide Signal:   %s   cut: 24 range:24-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKSLEIRFLFPLVLFLVLCVDGKRFNNNGHKMRKGRWEGKLKMNFYHKSCPKAEEIVKEIVSKKVAENPSLAPKLLRVHYHDCFVRGCDASLLLDSVAGKAASEKEARPNLSLSGFEIIDEIKSILEKRCPKTVSCADILTLAARDAVSYEFERPLWNVFTGRVDGRVSLATEAARDLPSAGANFTTLQKLFAESDLDVVDLVALSGAHTIGTAHCGVFGRRLLNFTGKGDTDPSLNPSYASFLKSECSDKSLRFNSSAVVGMDPTGPLTFDSGYFVSLLKNKGLFTSDAALLTDPSAAHIASVFQNSKTFLAQFGRSMIKMSSIKVLTLGDQGGEIRRNCRLVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGAGTTTAGAGATTCGGTTTTTATTTCCACTTGTTTTGTTTTTGGTACTTTGTGTTGATGGTAAGAGATTCAATAATAATGGCCACAAGATGAGAAAAGGCAGATGGGAAGGT
AAGCTGAAGATGAACTTCTATCACAAAAGTTGTCCTAAAGCTGAGGAAATCGTGAAAGAGATTGTGTCGAAGAAAGTCGCAGAAAACCCTAGCTTGGCTCCCAAGTTACTAAGGGTTCAT
TACCATGACTGCTTTGTTAGG
GTATGATATGCATGTTAGCATGTAGTTTTTTTTTTTTCCTTTATGTGAGCATGCATCTTTCTTATAAAGATAAGTCTAATGTGGATCATTGATGATATT
TAGGGGTGCGACGCATCACTGCTTTTAGATTCAGTTGCTGGAAAAGCCGCGTCCGAGAAGGAAGCCAGACCTAATCTCTCGCTATCCGGGTTCGAAATCATCGATGAGATCAAGTCCATT
CTGGAAAAACGATGCCCTAAAACCGTCTCTTGCGCAGACATTCTCACCTTAGCCGCCAGAGATGCCGTCTCATATGAA
GTAATATATATGAACAAACTCGTCTAAAAATATCTCATGATT
AGAAATCACAAATTTAGTATTTTACTAATCGCATATGGTACTTTAGATGTCTTGCTTATCAAATGAAACCAAGAATCAGTTATAATTCCCCTGTGTTTTTATGTTTGATATGTTATAGTT
TGAACGGCCGCTATGGAATGTGTTTACGGGTCGTGTTGATGGACGAGTTTCATTGGCAACGGAGGCGGCCAGAGACTTACCGTCCGCTGGGGCAAACTTCACCACTCTACAGAAACTCTT
TGCCGAAAGCGATTTGGACGTCGTTGACCTCGTCGCTTTATCAG
GTTTAGCATATTTCGTATATATTATTTTTTTGTTTCATCACATTTTACATATACTGATAAGACCAACCATGAAATT
GGGAACAATTGAATTATAAGAAAATCGCAAGAGTATCAGACCACATGCATGTCCATGTTAGGAAGTGTATGAGATGCTACAAATTTAATTCTTCCAATTTACAAGAAATAGTATAAAATA
CGATGAACATCAAATATTTGAGGATAATCTTGGAAGAGGCGTCGCACGTGATAATTATTCAAAAGTCAATTAATTTTCTTAGAAATGATCTAATTTTTTCATATAAATTACTCAATAATT
AACTAATTTTTAATGGAAGCAAATTTTCGAGTCTATTAAAAAGAAACGAAATTCTATGAAAAACAGGAGCACACACGATAGGAACAGCACATTGCGGTGTGTTTGGTCGGAGGCTCTTAA
ACTTCACCGGAAAAGGAGACACAGATCCTTCCCTGAACCCTAGCTACGCCTCTTTCCTCAAATCCGAATGCTCCGACAAATCTCTAAGATTCAACTCCTCCGCAGTGGTTGGAATGGACC
CTACCGGGCCTCTCACCTTTGACAGTGGCTACTTCGTCTCTCTCCTCAAGAACAAAGGACTCTTCACCTCCGACGCCGCCTTGTTGACTGATCCCTCCGCCGCTCACATTGCTAGTGTTT
TCCAAAACTCCAAAACTTTTCTTGCTCAGTTTGGTCGGTCCATGATCAAGATGAGTTCCATTAAAGTCCTTACTCTTGGAGATCAAGGTGGTGAGATTCGTAGAAATTGTCGCCTCGTCA
ACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGAGTTTAGAGATTCGGTTTTTATTTCCACTTGTTTTGTTTTTGGTACTTTGTGTTGATGGTAAGAGATTCAATAATAATGGCCACAAGATGAGAAAAGGCAGATGGGAAGGT
AAGCTGAAGATGAACTTCTATCACAAAAGTTGTCCTAAAGCTGAGGAAATCGTGAAAGAGATTGTGTCGAAGAAAGTCGCAGAAAACCCTAGCTTGGCTCCCAAGTTACTAAGGGTTCAT
TACCATGACTGCTTTGTTAGG
GGGTGCGACGCATCACTGCTTTTAGATTCAGTTGCTGGAAAAGCCGCGTCCGAGAAGGAAGCCAGACCTAATCTCTCGCTATCCGGGTTCGAAATCATC
GATGAGATCAAGTCCATTCTGGAAAAACGATGCCCTAAAACCGTCTCTTGCGCAGACATTCTCACCTTAGCCGCCAGAGATGCCGTCTCATATGAA
TTTGAACGGCCGCTATGGAATGTG
TTTACGGGTCGTGTTGATGGACGAGTTTCATTGGCAACGGAGGCGGCCAGAGACTTACCGTCCGCTGGGGCAAACTTCACCACTCTACAGAAACTCTTTGCCGAAAGCGATTTGGACGTC
GTTGACCTCGTCGCTTTATCAG
GAGCACACACGATAGGAACAGCACATTGCGGTGTGTTTGGTCGGAGGCTCTTAAACTTCACCGGAAAAGGAGACACAGATCCTTCCCTGAACCCTAGC
TACGCCTCTTTCCTCAAATCCGAATGCTCCGACAAATCTCTAAGATTCAACTCCTCCGCAGTGGTTGGAATGGACCCTACCGGGCCTCTCACCTTTGACAGTGGCTACTTCGTCTCTCTC
CTCAAGAACAAAGGACTCTTCACCTCCGACGCCGCCTTGTTGACTGATCCCTCCGCCGCTCACATTGCTAGTGTTTTCCAAAACTCCAAAACTTTTCTTGCTCAGTTTGGTCGGTCCATG
ATCAAGATGAGTTCCATTAAAGTCCTTACTCTTGGAGATCAAGGTGGTGAGATTCGTAGAAATTGTCGCCTCGTCAACTAA

Retrieve as FASTA