Entry information : AlyPrx40
Entry ID 7558
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-03-21 (Christophe Dunand)
Peroxidase information: AlyPrx40
Name AlyPrx40
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx40
start..stop
S start..stop
AhalPrx40 739 0 1..362 1..362
BstrPrx61 703 0 1..362 1..362
AtPrx40 699 0 1..362 1..362
CagraPrx20 677 0 15..362 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12228803..12229129 327 N° 2 12228432..12228623 192 N° 3 12228169..12228334 166 N° 4 12227687..12228090 404
complement(join(12227687..12228090,12228169..12228334,12228432..12228623,1222880 3..12229129))


exon

Literature and cross-references AlyPrx40
DNA ref. Phytozome 12:   scaffold_7 (12229129..12227687)
Protein sequence: AlyPrx40
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (329)
PWM (Da):   %s   38882.1 (34921.0) Transmb domain:   %s   i17-34o
PI (pH):   %s   4.44 (4.18) Peptide Signal:   %s   cut: 34 range:34-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLKLRRKWSDHITTMKNLFNLFLMLFAAMPILSFSDNPTNFSESCEDGSGETGSSFGIGFGLVLDFGLYRNSCPEAESIVYSWVETTVLQDPRMAASLLRLHFHDCFVNGCDASVLLDDTEGLVGEKTAPPNLNSLRGFEVIDSIKSDLESVCPETVSCADILAMAARDSVVVSGGPSWEVEVGRKDSRTASKQAATNGLPSPNSTVPTLISTFQNLGLSQTDMVALSGGHTLGKARCSSFTARLQPLQTGQPANHGDNLEFLESLQQLCSTVGPTVGITQLDLVTPSTFDNQYYVNLLSGEGLLPSDQALAVQDPGTRAIVETYAADQSVFFEDFKNAMVKMGGITGGSNSEIRRNCRMIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTAAAACTCAGAAGAAAGTGGAGTGATCATATAACGACAATGAAGAATCTCTTTAACTTGTTCCTTATGCTTTTCGCTGCAATGCCAATTCTCTCATTCTCCGACAATCCAACCAAC
TTCAGCGAGAGTTGCGAAGACGGGAGTGGAGAAACCGGTTCAAGTTTTGGTATAGGGTTCGGTTTGGTTCTTGATTTCGGTTTGTACCGGAATAGCTGTCCGGAAGCAGAGTCCATAGTC
TACTCGTGGGTCGAAACCACGGTGTTACAGGATCCAAGAATGGCTGCTTCTCTTCTCCGTCTTCATTTCCACGACTGTTTTGTCAAT
GCAAGTCTATTTCATCTTAAGTTCGTTTTAACT
GTTTTGGTCAATTATCTAATCCCGTCTTTTATATACCATTGAACCGGGAAAGTATTAACTATGCTGGTTAAACCGTGATAAATCCAAATTGGTACCGGTTAAGTAGAACAAGATGTGTTT
TTTGACTTACCTCGTGCATTTTGCAGGGATGTGATGCTTCGGTGTTGTTGGACGACACGGAAGGACTGGTTGGTGAAAAAACTGCGCCTCCTAATCTAAATTCTCTCCGAGGGTTCGAAG
TAATAGATTCGATAAAGTCTGATCTTGAATCTGTATGTCCAGAAACCGTCTCATGCGCAGACATTCTTGCCATGGCCGCTAGAGATTCAGTCGTTGTG
GTAACTATATCTTCAGCCTTAC
TAATCACCATCTTATAAACCGGATGAACTCAATTCAAATCATCTTGGTTAACTCTTTTAAATCGGGTTTTTGAAGTCGGGTGGACCAAGCTGGGAGGTGGAAGTAGGAAGAAAAGACAGT
AGAACAGCGAGCAAACAGGCAGCAACAAATGGCTTACCCTCACCAAACTCAACCGTACCAACTCTCATATCTACCTTCCAAAATCTTGGCCTTTCACAAACCGACATGGTCGCTCTTTCC
G
GTATACATTCTCTTGTACTTTTCGTTCTCTTTCTCAAGATCAACCCAAGATATTGATACTTAACCAAATGGAAATCAGGTGGACATACATTGGGAAAGGCAAGGTGCAGTTCGTTTACA
GCTCGGTTGCAGCCACTGCAAACTGGACAACCGGCTAACCATGGAGACAACCTTGAGTTCCTCGAGTCACTACAACAGTTGTGCTCGACCGTGGGCCCTACTGTCGGTATCACTCAGCTT
GACCTGGTGACCCCATCAACATTTGACAACCAGTACTATGTAAACCTCCTCTCAGGTGAGGGATTGCTTCCATCAGACCAAGCTTTAGCGGTTCAAGACCCAGGGACAAGGGCGATTGTT
GAGACCTACGCAGCAGATCAGTCGGTTTTCTTTGAGGATTTTAAGAACGCTATGGTTAAAATGGGAGGGATTACCGGTGGTAGTAATAGCGAGATTAGGAGGAACTGTAGAATGATTAAC
TAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTAAAACTCAGAAGAAAGTGGAGTGATCATATAACGACAATGAAGAATCTCTTTAACTTGTTCCTTATGCTTTTCGCTGCAATGCCAATTCTCTCATTCTCCGACAATCCAACCAAC
TTCAGCGAGAGTTGCGAAGACGGGAGTGGAGAAACCGGTTCAAGTTTTGGTATAGGGTTCGGTTTGGTTCTTGATTTCGGTTTGTACCGGAATAGCTGTCCGGAAGCAGAGTCCATAGTC
TACTCGTGGGTCGAAACCACGGTGTTACAGGATCCAAGAATGGCTGCTTCTCTTCTCCGTCTTCATTTCCACGACTGTTTTGTCAAT
GGATGTGATGCTTCGGTGTTGTTGGACGACACG
GAAGGACTGGTTGGTGAAAAAACTGCGCCTCCTAATCTAAATTCTCTCCGAGGGTTCGAAGTAATAGATTCGATAAAGTCTGATCTTGAATCTGTATGTCCAGAAACCGTCTCATGCGCA
GACATTCTTGCCATGGCCGCTAGAGATTCAGTCGTTGTG
TCGGGTGGACCAAGCTGGGAGGTGGAAGTAGGAAGAAAAGACAGTAGAACAGCGAGCAAACAGGCAGCAACAAATGGCTTA
CCCTCACCAAACTCAACCGTACCAACTCTCATATCTACCTTCCAAAATCTTGGCCTTTCACAAACCGACATGGTCGCTCTTTCCG
GTGGACATACATTGGGAAAGGCAAGGTGCAGTTCG
TTTACAGCTCGGTTGCAGCCACTGCAAACTGGACAACCGGCTAACCATGGAGACAACCTTGAGTTCCTCGAGTCACTACAACAGTTGTGCTCGACCGTGGGCCCTACTGTCGGTATCACT
CAGCTTGACCTGGTGACCCCATCAACATTTGACAACCAGTACTATGTAAACCTCCTCTCAGGTGAGGGATTGCTTCCATCAGACCAAGCTTTAGCGGTTCAAGACCCAGGGACAAGGGCG
ATTGTTGAGACCTACGCAGCAGATCAGTCGGTTTTCTTTGAGGATTTTAAGAACGCTATGGTTAAAATGGGAGGGATTACCGGTGGTAGTAATAGCGAGATTAGGAGGAACTGTAGAATG
ATTAACTAA

Retrieve as FASTA