Entry information : AlyGPx06
Entry ID 7571
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyGPx06
Name AlyGPx06
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyGPx06
start..stop
S start..stop
AtGPx06 431 4e-156 1..235 1..232
ThasGPx06-1 357 7e-127 1..235 1..242
ThasGPx06-2 353 4e-125 1..235 1..241
BnGPx06-2_other 345 4e-123 67..235 1..169
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21316827..21317072 246 N° 2 21316654..21316730 77 N° 3 21316494..21316555 62 N° 4 21316292..21316410 119
N° 5 21315707..21315874 168 N° 6 21315572..21315607 36  
complement(join(21315572..21315607,21315707..21315874,21316292..21316410,2131649 4..21316555,21316654..21316730,21316827..21317072))


exon

Literature and cross-references AlyGPx06
DNA ref. Phytozome 11:   scaffold_6 (21317072..21315572)
Protein sequence: AlyGPx06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   235
PWM (Da):   %s   25890.38  
PI (pH):   %s   9.71
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLRSSIRLLYIRRTSPLLRSLSSSSSSSSSSSSKRFDSAKPLFNSHRIISLPISTTGAKLSRSEHSMATSSEPKSIYDFTVKDAKGNDVDLSIYKGKVLLIVNVASQCGLTNSNYTELAQLYEKYKDGFEILAFPCNQFGNQEPGTNEEIVQFACTRFKAEYPIFDVDVNGDKAAPIYKFLKSSKGGLFGDGIKWNFAKFLVDKDGNVVDRYAPTTSPLSIEKDLKKLLGVTA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCGATCCTCAATTCGACTTCTCTATATAAGAAGAACCAGTCCTCTCCTTCGAAGTTTATCATCATCATCATCATCATCATCATCATCTTCATCAAAACGATTCGATTCTGCGAAA
CCACTTTTCAATTCTCATCGGATTATTTCTCTTCCAATCTCTACAACGGGTGCTAAACTTTCTAGATCGGAACATTCAATGGCTACTTCTTCCGAACCCAAATCTATCTACGATTTCACC
GTCAAG
GTTCGATTTTAATTTCTTTTATTAGATCGGAAATTTGTGTTTGTTGATTGGATTTGTGATCCGATTTTGAACGATTTGAGTCTGGAATTGAATTAGGATGCTAAGGGAAACGAT
GTTGATCTAAGCATCTACAAGGGGAAGGTTCTTTTGATTGTGAACGTTGCTTCTCAATG
GTAAAACTTCGATATTTGTGTAACACACAGGCTTGATTTGTGATCATAAATTCATTGGTTA
GTGACTTAGTTTCTTTGGTGTTTGAATTTTCATGCAGTGGCTTGACTAATTCGAACTATACTGAGCTTGCACAGCTTTATGAGAAGTACAAAGACCATGGTATATAATTACTAGTTGTTT
GTTTGTTTGTAATCATGGGTTGTGATTTTGTTTGTTGTTGATGGTTACGATTTTTGATTCAGGGTTTGAGATTCTTGCGTTCCCGTGTAATCAGTTTGGGAATCAAGAGCCTGGTACAAA
TGAAGAGATTGTTCAGTTTGCTTGTACTCGTTTCAAGGCTGAGTACCCGATTTTCGACAAG
GTAGCAACTTTTCTTGTTCTGTGATTCTTTCTAGTTCAGTCGTATTTTAACATCTTGGG
ATATACTAGTTCTTCGTTTTAGTTTGAAACAAGAGTAATCCCATTTTGAATGAAGAAGTTATTTAGTTTCGATTTCGTAGTTTTTCGCATTTCTTGAGTAAACCCTCGAGATGAGGTAGC
ACTTTTCAATTGTCCACTATCTCAAATTCATTCAGACATGATATGTGAGAATGTTGCAAGCTCTAATAGTATCATTGAACCATTTTTGGATCATGTAGTTGAAACTAATAACTTTTTCGT
TCAAAATGGGTGACTCTGTGTTTCAAACTACAACCAAGAATTCAAGCTCTTTCAGTATCAGTGAATCATTTTCAGATCTCTACTTGGACTTGATTCTTTTACCTTTGCACTAATACAGGT
TGATGTGAACGGTGACAAAGCTGCTCCAATCTACAAGTTTCTGAAATCAAGCAAAGGCGGGCTTTTTGGAGACGGCATCAAGTGGAACTTCGCTAAGTTCTTGGTTGACAAAGATGGAAA
TGTTGTTGACCGTTACGCGCCAACTACTTCTCCTCTCAGTATTGAG
GTAATAATGTCTCTATCACATATAATCATCAAATACTTGAGTTTTGTTTAGAGCCTCAGTTTCTAATTGCTTTG
TTACATCGTTGTTTCGCAATTGCAGAAGGACCTGAAGAAACTGTTGGGAGTTACTGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCGATCCTCAATTCGACTTCTCTATATAAGAAGAACCAGTCCTCTCCTTCGAAGTTTATCATCATCATCATCATCATCATCATCATCTTCATCAAAACGATTCGATTCTGCGAAA
CCACTTTTCAATTCTCATCGGATTATTTCTCTTCCAATCTCTACAACGGGTGCTAAACTTTCTAGATCGGAACATTCAATGGCTACTTCTTCCGAACCCAAATCTATCTACGATTTCACC
GTCAAG
GATGCTAAGGGAAACGATGTTGATCTAAGCATCTACAAGGGGAAGGTTCTTTTGATTGTGAACGTTGCTTCTCAATGTGGCTTGACTAATTCGAACTATACTGAGCTTGCACAG
CTTTATGAGAAGTACAAAGACCATG
GGTTTGAGATTCTTGCGTTCCCGTGTAATCAGTTTGGGAATCAAGAGCCTGGTACAAATGAAGAGATTGTTCAGTTTGCTTGTACTCGTTTCAAG
GCTGAGTACCCGATTTTCGACAAG
GTTGATGTGAACGGTGACAAAGCTGCTCCAATCTACAAGTTTCTGAAATCAAGCAAAGGCGGGCTTTTTGGAGACGGCATCAAGTGGAACTTCGCT
AAGTTCTTGGTTGACAAAGATGGAAATGTTGTTGACCGTTACGCGCCAACTACTTCTCCTCTCAGTATTGAG
AAGGACCTGAAGAAACTGTTGGGAGTTACTGCTTAA

Retrieve as FASTA