Entry information : AlyRboh10 (AlyRbohJ)
Entry ID 7576
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-10 (Catherine Mathe)
Peroxidase information: AlyRboh10 (AlyRbohJ)
Name (synonym) AlyRboh10 (AlyRbohJ)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyRboh10
start..stop
S start..stop
AtRboh10 1743 0 1..912 1..912
AtRboh08 1523 0 9..912 7..886
AlyRboh08 1521 0 1..912 1..886
ThasRboh10 1466 0 1..912 1..900
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12257568..12258051 484 N° 2 12257254..12257416 163 N° 3 12257020..12257182 163 N° 4 12255585..12256391 807
N° 5 12255388..12255483 96 N° 6 12255154..12255269 116 N° 7 12254947..12255049 103 N° 8 12254723..12254826 104
N° 9 12254468..12254627 160 N° 10 12254157..12254381 225 N° 11 12253741..12253869 129 N° 12 12253545..12253623 79
N° 13 12252885..12252994 110  
complement(join(12252885..12252994,12253545..12253623,12253741..12253869,1225415 7..12254381,12254468..12254627,12254723..12254826,12254947..12255049,12255154..1 2255269,12255388..12255483,12255585..12256391,12257020..12257182,12257254..12257 416,12257568..12258051))


exon

Literature and cross-references AlyRboh10 (AlyRbohJ)
DNA ref. Phytozome 11:   scaffold_5 (12258051..12252885)
Protein sequence: AlyRboh10 (AlyRbohJ)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   912
PWM (Da):   %s   102675.81 Transmb domain:   %s   o466-488i509-531o541-558i701-718o
PI (pH):   %s   9.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNNNRKVGTEDSTKWMLESVEIDPKGESSVKQSENTINSNNPESSGSGGGILKNVSKNLGVGSIIRSMSVNKWRKSGNLGPPSTRKSGNLGPPLPIAQEKRPGPQRVERTTSSAARGLQSLRFLDRTVTGRERDSWRSIENRFNQFAVDGRLPKDKFGVCIGMGDTLEFAAEVYEALGRRRQINTENGIDKEQLKLFWEDMIKKDLDCRLQIFFDMCDKDGDGKLTEEEVKEVIVLSASANRLANLKKNAASYASLIMEELDPDQHGYIMWQLEVLLTGIVSNAESHKVVRKSQQLTRAMIPKRYRTPTSKYVSVTAELMYEHWKKIWVVTLWLAVNAALFIWKYEEFTTSPLYNITGRCLCAAKGTAEILKLNMALILVPVLRRTLTFLRSTFLSHLIPFDDNINFHKLIAVAIAVISLLHTALHMLCNYPRLSACPNDLYYDYAGNLLGFMQPTYLGLMLTPVSVTGVLMIIFMGISFTLAMHYFRRNIVKLPKPFNRLAGFNSFWYAHHLLVIAYALLIIHGYILIIEKPWYQKTTWMYVAIPMVLYASERLFSRVQEHNHRVHIIKAIVYSGNVLALYMTKPQGFKYKSGMYMFVKCPDISKFEWHPFSVTSAPGDEYLSVHIRALGDWTSELRNRFATCEPHQTSKPSPNSLIRMETRARGANPHVEESQALFPRIFIKGPYGAPAQNYQKYDILLLIGLGIGATPFISILKDMLNNLKPGIPRGQKYEGSVGGESLGGSSVNGGSSVNGGSSVNGGGSVSGGGRKFPQRAYFYWVTREQASFEWFKGVMDDIAVYDKTNVIEMHNYLTSMYEAGDARSALIAMVQKLQHAKNGVDIVSESRIRTHFARPNWRKVFSELSSKHETSRIGVFYCGSPTLVRPLKSLCQEFSLESSTRFTFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 12 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACAACAATAGAAAGGTTGGGACCGAAGATTCAACGAAATGGATGTTAGAGAGCGTCGAGATAGATCCAAAAGGCGAGAGTTCCGTGAAACAATCCGAAAACACAATCAATAGCAAT
AATCCCGAGAGTAGTGGTAGTGGTGGTGGGATCTTGAAGAATGTGTCTAAGAATCTTGGCGTGGGATCGATAATCAGGTCCATGAGTGTAAACAAATGGAGAAAGAGCGGTAATCTCGGG
CCCCCGAGCACGAGGAAGAGTGGAAACTTGGGGCCTCCGCTCCCTATTGCCCAAGAAAAAAGACCGGGGCCACAAAGAGTCGAGAGGACTACATCTAGTGCGGCTAGAGGACTACAAAGC
CTACGGTTCCTTGATCGGACTGTCACAGGACGGGAACGGGATTCGTGGAGATCAATCGAGAACCGGTTCAATCAATTTGCCGTTGACGGGAGGCTTCCCAAGGATAAATTCGGTGTTTGC
ATTG
GTAAAACTAAAATTCATCCTTTTTTTTTACGTAAATGTAATTTAAAAAAATAAGGTCACACTTTATGTTTTTTGTCAACTTTAAAAGGTTGTTATTCAAAATGAAATATATAAAAT
GTTGTTTTCATGTTATAATTATGTTTGTGTAATAGGAATGGGAGATACATTGGAGTTTGCGGCAGAAGTATATGAAGCATTGGGTAGGAGAAGACAAATAAACACAGAAAATGGGATTGA
TAAGGAACAACTCAAGCTTTTTTGGGAAGACATGATCAAGAAAGATCTCGACTGTCGCCTCCAGATCTTCTTCGACAT
GTAACTACTTTTTATTATGTTGGTTTTAATTTGAAAATATAT
AGCAACAAAGGTTAACAATTGCGGTTTAGGTGTGACAAGGATGGAGACGGGAAGTTAACAGAAGAGGAAGTTAAAGAGGTCATAGTCTTGAGTGCATCAGCGAACAGGCTCGCTAATCTA
AAGAAGAATGCTGCATCTTATGCTTCTTTGATCATGGAAGAACTCGACCCCGACCAACACGGTTACATTGAG
GTATCATTTTGATTCCATTTCCATAATCTACGATATATTAGAGTGACC
ATGTGAAATTTTCAGACTTGTAGGTCTAAAAATGTAGATCAACTAGTTATTGGTTAATGTAATTATTGGTTCATCGTTTTGAAGCTAGGGTATAATCAAACAATTCGAAGTTATTTGTCA
TATATATGAAAATAGTAACGTTAAAAAAAAACTATGATATAGCTTGCAAAAGCTAAATAGTTTTGGACACGGAGATTAGCCTTTCTAAAAAAGAAAATTCCCCGGCTATAGACAAAAAAA
AACAGGAACTTTGGTGAATTCAGTTTTTGGTTTTTGGTTTCAGTTTAAAAAAAAAAAATCATATAGCTTTAGGTTTTATATATAAAAGTACTAAATACGAAAAAAAAAATATAAGTATAC
ATTGCATGCGTTGTCCACGCTGCAATATCTTTTAGTTATTATATGAAAATGATAAATATAGTAGAAAATGGTAATTTTAGGTTTTACGAAATCGAAACCTAATTAATATTGATGTTAAAT
CCAAAACTATATCTTCATGTTGCATATTTTTTGTTAAAACATATATCTTTGTGTTACATGCCTCGTCCACTCTGACATTTCTTTAGTTTACATCAACCAGATGTGGCAACTCGAGGTGTT
ATTAACAGGAATTGTATCAAACGCTGAGTCACATAAGGTGGTGAGGAAATCGCAACAGCTAACGCGAGCCATGATCCCAAAACGTTACAGAACACCGACTAGTAAATACGTTTCAGTAAC
CGCCGAGCTAATGTACGAGCACTGGAAAAAGATTTGGGTCGTTACATTGTGGCTCGCAGTAAACGCCGCCCTCTTCATATGGAAATACGAAGAGTTCACCACAAGCCCTCTTTACAACAT
CACCGGACGCTGCCTTTGCGCCGCGAAAGGAACTGCGGAAATACTTAAACTCAACATGGCTTTGATCTTGGTCCCTGTTTTAAGAAGAACCCTTACGTTCCTCAGATCGACTTTCTTGAG
CCACCTGATCCCGTTCGATGATAACATCAACTTCCATAAGTTGATAGCGGTGGCGATAGCGGTTATTTCCTTGCTCCACACGGCACTACACATGCTATGCAACTATCCTAGGCTAAGTGC
TTGCCCTAACGATTTGTACTATGATTACGCGGGAAATCTCTTGGGGTTCATGCAACCGACCTATTTAGGTCTAATGCTGACCCCGGTTTCGGTCACAGGAGTTCTAATGATCATCTTCAT
GGGTATCTCATTCACGCTTGCTATGCATTACTTCAGAAGAAACATAGTGAAATTGCCTAAACCGTTTAACCGTCTTGCTGGATTTAATTCGTTTTGGTATGCTCATCATTTGCTGGTTAT
TGCCTATGCTCTTCTTATCATTCATGGTTACATTCTTATCATCGAGAAGCCTTGGTACCAAAAAACG
GTAAGTTTATACATATAAATACTAAAATGAATATATGTTAGGAGATATACAAT
CAAACTTTAGTATTTCTTAAAAATATTTGTTTGTATGGGAAAATGTAGACATGGATGTACGTGGCCATACCAATGGTGTTGTACGCGAGCGAGAGGCTTTTCTCAAGAGTTCAAGAACAC
AACCATCGTGTCCATATTATAAAG
GTATAATTAAGATTCTTGTATTGTCCTGCTTACAACATTATTAAATTATGAAGATTGTCAAATGTAATAATAACAATTTAATTGTGTTTTCTTTCC
TCGTAAATTTTTGCATGCCTAGGCTATTGTATATTCAGGCAATGTTCTTGCACTCTATATGACAAAACCTCAAGGGTTCAAGTACAAAAGTGGCATGTACATGTTTGTCAAGTGTCCTGA
TATCTCCAAATTCGAATG
GTAATAACATCTTTTTCAAAAAAGGATCTAACCAATTCATATAACCTATATATTTATTTATTTATTTCTATCATTGTACTTATCATTTTGTCTTTGTGGTTT
AGGCATCCATTCTCCGTCACTTCTGCACCCGGAGATGAATATTTGAGCGTTCACATAAGAGCATTAGGAGATTGGACCTCTGAACTTAGGAACAGATTTGCAGAGGTAATTTTCTTAATT
TGTCTTTTCAAATTTTTTAACATTTATCATTTTCAATAAACACTCATCTTAACCAAAATTAAACTCCAAATTTGATTTTATATAGTAAATTCTTGTTTCTTGTAGACATGTGAGCCTCAT
CAAACATCGAAACCTAGTCCAAATAGTCTTATTAGGATGGAAACAAGAGCGAGAGGTGCAAATCCTCACGTTGAAGAATCACAAGCCTT
GTAAGTGAATATATTTACTACCAAATCCATG
CACGGATATTTCAACATAAGCTGATCGAAATATGATCTCATCCTATCCATATCTTCACAACCAGATTTCCAAGAATTTTTATCAAAGGACCATACGGAGCTCCGGCACAAAACTATCAGA
AGTATGATATCCTTTTGTTGATTGGGCTAGGGATAGGGGCAACCCCATTTATAAGTATCCTAAAAGACATGTTGAACAATCTCAAACCTGGTATTCCAAGAGCC
GTAAGTAATCTACAAC
CATAGTGAGTCTTGGAGAAACAAAGTCTATCTATGAAAAAGTGATGGGGTGTGAAATTTGGAAAATGTAGGGGCAAAAGTATGAAGGAAGTGTAGGAGGTGAGAGCTTAGGAGGATCAAG
TGTAAATGGAGGATCGAGTGTAAATGGAGGATCTAGTGTAAATGGAGGAGGTAGTGTAAGTGGAGGAGGTAGGAAGTTTCCACAAAGAGCATATTTTTACTGGGTGACAAGAGAACAAGC
TTCTTTCGAATGGTTCAAAGGAGTTATGGATGATATTGCAGTGTATGACAAAACC
GTAAGTTCTTATATCCAGTTTTATCATATATTAATAGATTTTAAATGATGTTAAATAAGATTTTC
ATATCAGAATTTCTGATAGTCTAATAAAGTACAAAATTATTTTTATAATGTTGAAAGAAAAAACTTAAATTGTTTTTTTTTTCCATAGAAATTCTAAGTAATTAAAACTGAAACATCATG
AAAAGAAAAATAATTTGATGAGAAATTTTAATGATGAAATGCAAATTTAAAATAGATATCTTTATCTATATATTATTTTTCATTCGTTTTTTGTATTGACAGAATGTGATAGAGATGCAT
AACTACTTAACAAGTATGTACGAAGCAGGAGATGCAAGATCTGCTCTAATTGCTATGGTCCAGAAACTTCAACATGCCAAAAATGGTGTTGACATTGTGTCCGAGAGCCGA
GTATGTTCA
TTTTTTTGTACATTATATTATCCATTTAATATTTTATTTACAAATAGTTATACTTTTCATCGTGTTATATACAAATACAATATATTTCTAATATTCCACCTGATTCAGATACGAACCCAT
TTCGCAAGACCTAATTGGAGGAAGGTTTTTTCTGAATTGTCAAGCAAGCACGAAACTTCTCGCATAG
GTACGTAAATATTGTTTCTCCTAATTTACTTAAAACATTCTTTAGTACTGTTG
CTAGCAAAATGTTTTAGTGTATTTTTACTAATTAAATATTTAAAGTGTAGTTCTCACACCATCTAAGAAACTTAGGGAATTTTCATGTATTTACCTTGAACCTTTTTTTTTTATATATTC
AACTAGTTGCATATAAAGCACTTTAATGAATATTTACAATCTTAGCAAAAAAAAAAAAAAAAAAATTAAGCACTTATTTTTCTTGCATATTTATTAAGAAAATTTTGAAACTAGCTAAGT
AATAAACAAGGTAAACAATATTTGATTTAGTATATTCTGGTCTGACTTTTTTGGAATTTTTGTACTTTTTTTTTTTTGTCATCGAATTTTTGTACTTTGAATGATAAAGATATCTTAAAT
TTTAGTAGTTCATTTGGTAAAGAAAAATTTCAAAGATTTAGTTAATATTTATTTGGGATGAAAAATCTAATACATTTAATTTGAAATTTAATGTACATGATTTTTTTTTAGATTAATTTT
AATTTGTATTGTTTCAGGTGTGTTCTACTGTGGAAGTCCAACGCTTGTTCGACCACTAAAATCCCTTTGTCAGGAGTTCAGTCTCGAGTCGTCCACCCGCTTTACTTTCCACAAAGAGAA
TTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACAACAATAGAAAGGTTGGGACCGAAGATTCAACGAAATGGATGTTAGAGAGCGTCGAGATAGATCCAAAAGGCGAGAGTTCCGTGAAACAATCCGAAAACACAATCAATAGCAAT
AATCCCGAGAGTAGTGGTAGTGGTGGTGGGATCTTGAAGAATGTGTCTAAGAATCTTGGCGTGGGATCGATAATCAGGTCCATGAGTGTAAACAAATGGAGAAAGAGCGGTAATCTCGGG
CCCCCGAGCACGAGGAAGAGTGGAAACTTGGGGCCTCCGCTCCCTATTGCCCAAGAAAAAAGACCGGGGCCACAAAGAGTCGAGAGGACTACATCTAGTGCGGCTAGAGGACTACAAAGC
CTACGGTTCCTTGATCGGACTGTCACAGGACGGGAACGGGATTCGTGGAGATCAATCGAGAACCGGTTCAATCAATTTGCCGTTGACGGGAGGCTTCCCAAGGATAAATTCGGTGTTTGC
ATTG
GAATGGGAGATACATTGGAGTTTGCGGCAGAAGTATATGAAGCATTGGGTAGGAGAAGACAAATAAACACAGAAAATGGGATTGATAAGGAACAACTCAAGCTTTTTTGGGAAGAC
ATGATCAAGAAAGATCTCGACTGTCGCCTCCAGATCTTCTTCGACAT
GTGTGACAAGGATGGAGACGGGAAGTTAACAGAAGAGGAAGTTAAAGAGGTCATAGTCTTGAGTGCATCAGCG
AACAGGCTCGCTAATCTAAAGAAGAATGCTGCATCTTATGCTTCTTTGATCATGGAAGAACTCGACCCCGACCAACACGGTTACATTGAG
ATGTGGCAACTCGAGGTGTTATTAACAGGA
ATTGTATCAAACGCTGAGTCACATAAGGTGGTGAGGAAATCGCAACAGCTAACGCGAGCCATGATCCCAAAACGTTACAGAACACCGACTAGTAAATACGTTTCAGTAACCGCCGAGCTA
ATGTACGAGCACTGGAAAAAGATTTGGGTCGTTACATTGTGGCTCGCAGTAAACGCCGCCCTCTTCATATGGAAATACGAAGAGTTCACCACAAGCCCTCTTTACAACATCACCGGACGC
TGCCTTTGCGCCGCGAAAGGAACTGCGGAAATACTTAAACTCAACATGGCTTTGATCTTGGTCCCTGTTTTAAGAAGAACCCTTACGTTCCTCAGATCGACTTTCTTGAGCCACCTGATC
CCGTTCGATGATAACATCAACTTCCATAAGTTGATAGCGGTGGCGATAGCGGTTATTTCCTTGCTCCACACGGCACTACACATGCTATGCAACTATCCTAGGCTAAGTGCTTGCCCTAAC
GATTTGTACTATGATTACGCGGGAAATCTCTTGGGGTTCATGCAACCGACCTATTTAGGTCTAATGCTGACCCCGGTTTCGGTCACAGGAGTTCTAATGATCATCTTCATGGGTATCTCA
TTCACGCTTGCTATGCATTACTTCAGAAGAAACATAGTGAAATTGCCTAAACCGTTTAACCGTCTTGCTGGATTTAATTCGTTTTGGTATGCTCATCATTTGCTGGTTATTGCCTATGCT
CTTCTTATCATTCATGGTTACATTCTTATCATCGAGAAGCCTTGGTACCAAAAAACG
ACATGGATGTACGTGGCCATACCAATGGTGTTGTACGCGAGCGAGAGGCTTTTCTCAAGAGTT
CAAGAACACAACCATCGTGTCCATATTATAAAG
GCTATTGTATATTCAGGCAATGTTCTTGCACTCTATATGACAAAACCTCAAGGGTTCAAGTACAAAAGTGGCATGTACATGTTTGTC
AAGTGTCCTGATATCTCCAAATTCGAATG
GCATCCATTCTCCGTCACTTCTGCACCCGGAGATGAATATTTGAGCGTTCACATAAGAGCATTAGGAGATTGGACCTCTGAACTTAGGAAC
AGATTTGCAGAG
ACATGTGAGCCTCATCAAACATCGAAACCTAGTCCAAATAGTCTTATTAGGATGGAAACAAGAGCGAGAGGTGCAAATCCTCACGTTGAAGAATCACAAGCCTTATTT
CCAAGAATTTTTATCAAAGGACCATACGGAGCTCCGGCACAAAACTATCAGAAGTATGATATCCTTTTGTTGATTGGGCTAGGGATAGGGGCAACCCCATTTATAAGTATCCTAAAAGAC
ATGTTGAACAATCTCAAACCTGGTATTCCAAGAGCC
GGGCAAAAGTATGAAGGAAGTGTAGGAGGTGAGAGCTTAGGAGGATCAAGTGTAAATGGAGGATCGAGTGTAAATGGAGGATCT
AGTGTAAATGGAGGAGGTAGTGTAAGTGGAGGAGGTAGGAAGTTTCCACAAAGAGCATATTTTTACTGGGTGACAAGAGAACAAGCTTCTTTCGAATGGTTCAAAGGAGTTATGGATGAT
ATTGCAGTGTATGACAAAACC
AATGTGATAGAGATGCATAACTACTTAACAAGTATGTACGAAGCAGGAGATGCAAGATCTGCTCTAATTGCTATGGTCCAGAAACTTCAACATGCCAAA
AATGGTGTTGACATTGTGTCCGAGAGCCGA
ATACGAACCCATTTCGCAAGACCTAATTGGAGGAAGGTTTTTTCTGAATTGTCAAGCAAGCACGAAACTTCTCGCATAGGTGTGTTCTAC
TGTGGAAGTCCAACGCTTGTTCGACCACTAAAATCCCTTTGTCAGGAGTTCAGTCTCGAGTCGTCCACCCGCTTTACTTTCCACAAAGAGAATTTCTGA

Retrieve as FASTA