Entry information : AlyRboh09 (AlyRbohI)
Entry ID 7577
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-10 (Catherine Mathe)
Peroxidase information: AlyRboh09 (AlyRbohI)
Name (synonym) AlyRboh09 (AlyRbohI)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyRboh09
start..stop
S start..stop
AtRboh09 1665 0 1..934 1..941
ThasRboh09 1217 0 1..934 1..918
CclRboh01 1138 0 8..934 5..946
CsRboh01 1137 0 8..934 5..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20872885..20873494 610 N° 2 20872644..20872809 166 N° 3 20872517..20872562 46 N° 4 20872017..20872136 120
N° 5 20871172..20871579 408 N° 6 20870696..20871082 387 N° 7 20870515..20870610 96 N° 8 20870294..20870409 116
N° 9 20869996..20870163 168 N° 10 20869754..20869913 160 N° 11 20869463..20869672 210 N° 12 20869256..20869384 129
N° 13 20869088..20869166 79 N° 14 20868899..20869008 110  
complement(join(20868899..20869008,20869088..20869166,20869256..20869384,2086946 3..20869672,20869754..20869913,20869996..20870163,20870294..20870409,20870515..2 0870610,20870696..20871082,20871172..20871579,20872017..20872136,20872517..20872 562,20872644..20872809,20872885..20873494))


exon

Literature and cross-references AlyRboh09 (AlyRbohI)
DNA ref. Phytozome 11:   scaffold_6 (20873494..20868899)
Protein sequence: AlyRboh09 (AlyRbohI)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   934
PWM (Da):   %s   106609.02 Transmb domain:   %s   o367-384i501-523o549-571i580-597o
PI (pH):   %s   8.44
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSMSFSGGTHDDRWGSDLTSAGEFTQSFPSFPATYSPSDGEELVEVTIEFPSGVLLNIESVTSTDPEITSCSASDSGSKSHSFGWSASSSRRISEFHTVEKAKKFSRDLKEKLQRISLGYSSRSAPEPVVPNVVDFTDPAVLCRSLTQRLTKSNGSCTERAINALKFISSKDNRIANWRDVQNNFANLSKDGYLCRSDFANCIGLENENSKEFADELFDAMCRRRRLMVDKINLQELYEFWYQITDESFDSRLQIFFDMVKNGDGRITENEVKIIILSASANNLLRLRERAEEYAALIMEELAPDGLYSQYIELKDLEMLLLEKDISHSYSQPFSQTSRALSQNLKDTRWGISRNLLYSLQDNWKRIWVLTLWLVIMGWLFMWKCYQYKRKDAFHVMGYCLVMAKGAAETLKFNMALILLPVCRNTITYLRSTALCHSVPFDDCINFHKTISVAIIIAMLLHASSHLACDFPRILTSTETDYKRYLVKYFGITRPTYFDLVNSPVGITGFIMVAFMVIAFILASRRCRRNLTKLPKPFDKLTGYNAFWYSHHLLLTVYVLLVIHGVSLYLEHKWYRKTIWMYLAVPVLLYIGERILRFFRSRLYTVEICKVVIYPGNVVVLRMTKPTSFDYKSGQYVFVQCPAVSKFEWHPFSITSSPGDDYLSIHIRQRGDWTEGIKKAFSVVCQAPEAGKSGLLRADGPNQRSFPELLIDGPYGAPAQDHWKYDVVLLVGLGIGATPFVSILRDLLNTIVKQQEQECLSGSCSNSNISSDHSFSCLNSEARSRIPQTQRKTLNTKNAYFYWVTREQGSFDWFKDIMNEIADSDRKGVIEMHNYLTSVYEEGDTRSNLLTMIQTLNHAKNGVDIFSGTKVRTHFGRPKWKKVLSKISTKHRNARIGVFYCGVPSLGKELSTLCHEFNQTGISRFEFHKEQF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 12 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAATGTCATTTTCCGGCGGGACTCACGACGATCGTTGGGGTTCCGATTTGACTTCCGCCGGAGAATTTACCCAAAGCTTTCCATCGTTTCCAGCAACTTACTCACCTTCCGACGGC
GAAGAGCTCGTAGAAGTAACAATCGAATTCCCAAGCGGCGTACTATTAAACATCGAATCTGTTACCAGCACCGATCCAGAGATTACCTCTTGCTCTGCTTCTGATTCAGGATCAAAATCG
CATAGTTTCGGATGGAGCGCGTCGTCGAGTCGTCGGATCTCAGAGTTTCATACGGTGGAGAAGGCGAAAAAGTTCTCTAGAGATCTGAAAGAAAAGCTTCAAAGGATCTCATTGGGATAT
TCGTCTCGGTCTGCACCGGAGCCGGTGGTTCCTAATGTAGTAGATTTTACGGATCCTGCTGTTCTCTGTCGCTCTTTAACACAACGATTAACAAAGTCTAATGGATCGTGTACAGAGAGA
GCGATTAATGCTTTGAAATTCATAAGCAGCAAAGACAATCGAATCGCTAATTGGAGAGATGTTCAAAACAATTTCGCTAATCTTTCTAAAGATGGTTATCTTTGTCGAAGTGATTTTGCT
AATTGCATAG
GTTCGACATTATTTCACATTTCTGATGAGTATATTGATTGATTAGTTTGACATTTGGTTGTTTTGTGTTTGAAAGGTTTGGAGAATGAAAATTCGAAAGAATTCGCAGAT
GAGTTGTTCGACGCAATGTGTAGGAGAAGAAGATTAATGGTTGATAAGATCAATCTTCAAGAACTATATGAGTTTTGGTACCAAATTACTGACGAAAGCTTCGATTCTCGTCTCCAAATC
TTCTTCGACAT
GTATTGATCATTTAATTAATATACTGATACACTTCTTCAACATGTAGTTAAGTTCTTGATTTGTTTTCTTGAAAATTGCAGGGTTAAAAATGGAGATGGTCGAATCACA
GAGAATGAAGTAAAAGAG
GTGACTTATTTAGTATTCTAATCAGCATTGACTACGTATAACTAATGAATCTTACATGAGTGCCATTATCTTATATTTTTAGTATTGTATTATCCCTCTTGC
TGAATTTTTTAGTTGGTTATGTTGGTCTTGATATGATTACATCTTATGTATTCTTTCTAAACCAATTAATGCAAGAATAGAAAACATAAGTTGCAATTGTTTTTTCTGCATAATATTTGA
TTGACCTTGTAGTATCTTTTCTTAATTTAAGGAAGTGTTCTAACTACCAATGAGAAGATATTGTTTTTCTATATAACCACTAAGTTTACGTTGAATCTTTCTAATAGAAGCTTCCTTTGG
GCATTAACTTCTTTTTGTATGATTTTGACAACATATAGATCATTATACTAAGTGCATCAGCAAATAATCTATTGAGGTTAAGAGAACGAGCAGAGGAATATGCAGCACTGATCATGGAAG
AACTTGCACCGGATGGGCTCTATTCTCAGTACATAGAG
GTGGTTCCATCACTTTTTAAGTAATATCACAATCTTGTAGATCAGTCTCTTTCTATGAGAGAGAGTAGAAGGGTTCTTTGTT
AAGTTTGACCTTAGTAATTGATGACGTTGAGCTCTCTTACCTTCCAAGTACTCTGATGATAGAGACATTTGACCGAGTCAAAAACCAATGAGCTTAAAGTTATGTGCTATGCAAGTTTCT
TTTTGTATGGAATTAATATAAGAAAAGGTTGACGAAGACAAAAAAAGTAGAGGTCCACATATAGAGCTTGAACAAATATTGTTCTCAAAATAATTTCTAGTGGTATAGTGGCGTTTCAGT
TATAGTAACAAATATTGTCAGAGAGAGTGCCCACTTGTTTGAATATTTTTCTCCTGCTTGAGACTGAAACAACATTCTAATATGTTGTCTTTGTTATGGATTTGGAATGATGCAGTTAAA
GGACCTAGAGATGCTACTACTAGAGAAGGACATATCTCATAGTTACAGCCAACCGTTCAGTCAGACGAGCCGAGCCTTAAGCCAAAACCTAAAGGATACAAGATGGGGAATAAGTAGGAA
CTTGCTTTACTCTTTGCAAGACAATTGGAAGAGGATTTGGGTTTTGACATTGTGGTTAGTGATCATGGGCTGGTTGTTTATGTGGAAATGCTATCAGTACAAACGCAAAGACGCATTCCA
TGTAATGGGTTACTGCCTTGTCATGGCGAAAGGTGCAGCTGAGACACTGAAATTCAATATGGCTCTTATCCTTTTGCCGGTCTGTAGAAATACCATCACCTATCTCAGATCCACCGCTTT
GTGCCACTCAGTGCCTTTCGATGACTGCATTAATTTTCACAAG
GTTAATCAAAAACCATTTTGTCTTGCCTTTCTTATGAAAGACAATATGTTTCAGCTGAATCTTACTTTCCGGTTTTT
GCTTAAGCGCAGACGATCTCTGTAGCAATCATTATTGCAATGCTTCTTCATGCATCCAGCCACCTCGCTTGTGACTTCCCGAGGATTCTAACATCTACTGAGACTGATTACAAAAGATAC
TTGGTTAAGTACTTTGGTATTACCAGACCCACATACTTTGACTTGGTGAATAGTCCTGTAGGAATCACTGGTTTTATAATGGTTGCTTTTATGGTAATTGCATTCATATTAGCCAGTCGA
AGATGCAGGCGGAACCTTACTAAGTTGCCAAAGCCATTTGACAAACTAACCGGATATAATGCCTTCTGGTATTCACATCACTTACTTCTAACTGTTTACGTCCTTTTAGTCATCCACGGT
GTTTCCCTCTATCTCGAGCATAAATGGTACCGCAAAACG
GTAAATTCCATAAACTTTTTACCATTACTTTTTGCATTCTTACATAATTTTCTGTAAAAACAATAACATATACTGCCTCCT
TCAGATATGGATGTATCTTGCTGTACCAGTTTTACTCTATATTGGTGAAAGGATCCTTAGATTTTTTCGTTCCAGGCTTTACACCGTTGAAATCTGCAAGGTAAAGTCTCACTACAATTA
CATTTTGAACTGAATCACATGGAAAGACACATTGTCAATCATCTTCCGCTATCTTTATATATCAATTCAAATGATTTGGTCTTAGGTTGTAATTTATCCCGGAAACGTTGTTGTACTACG
CATGACTAAGCCTACATCATTTGATTACAAGAGCGGACAATATGTATTTGTTCAGTGTCCTGCAGTGTCAAAATTTGAGTG
GTGAGTGTTTTTATAGTGAGCCAACACAAGCCTAATAGC
TTATTTTGCAATCTAAGAATATATACAAACTCTGTTCTTTGACACCACAAAGAGTAACTTAAAGATTCTTGGTCCTAAACTCCATCTCCAGGCATCCATTTTCTATTACGTCTTCCCCTG
GAGATGATTATCTCAGCATTCACATTCGCCAGCGTGGTGATTGGACAGAAGGGATTAAGAAGGCATTCTCAGTGGTATGTCAAGCCCCTGAAGCTGGAAAAAGCGGACTTCTCAGAGCAG
ACGGACCAAACCAAAGAAG
GTACATACATTTTATAGATTTCCATATACTATTAACTTGCATTCTCAGAATGTGAATTTTGATATTATCTCTTGTAATTTAGTTTTCCAGAGCTGTTGATA
GATGGACCTTATGGCGCTCCAGCGCAAGACCATTGGAAGTATGATGTGGTACTACTCGTTGGCCTTGGAATCGGCGCAACACCTTTCGTTAGCATTTTGAGAGATCTACTCAACACCATT
GTTAAGCAACAAGAACAAGCT
GTGAGTATAAACTTTAAAAATCCCTGTTGTTGAGTAACAGACTCTTAACTAACTTTTTTTTGTGTTATGTTATATTTTCAGGAATGCCTCTCAGGTAGT
TGTAGTAACAGCAACATCTCATCTGATCACAGTTTCAGTTGCTTAAACTCGGAAGCTCGGAGTCGGATTCCCCAAACTCAACGGAAGACGTTGAATACTAAGAACGCTTACTTTTATTGG
GTAACACGAGAACAAGGCTCGTTCGATTGGTTCAAAGATATCATGAACGAAATTGCTGATTCAGATAGAAAG
GTAATATACACTTATTCATGTAAATTCAAAAGATTGAAGTTAGTCACT
GACATATTTGTCTTTGTGAACAAATAAAAGGGTGTTATTGAGATGCACAACTACTTGACTAGCGTCTACGAAGAAGGAGATACTCGATCCAATCTTCTCACCATGATCCAAACGCTAAAC
CACGCTAAAAATGGCGTCGACATATTTTCTGGAACCAAG
GCAATTAATAATCTTTAACGATTACATTTATGATCTTATACAAACAACAATTGATTTCTGATCTTGTATACAACTTTTGGT
TATTTTAGGTAAGGACACATTTTGGGAGGCCAAAATGGAAGAAAGTTTTATCAAAGATTAGCACCAAACATAGGAACGCAAGAATTGGTACGTTACACAAGAATCAACTCAAAGAAATTA
TAATCGAGTCGGTATTTGCCTTGTCTAAAGAATTTGTTTTGATTAGGAGTGTTCTATTGTGGAGTACCGAGTTTGGGGAAGGAACTTTCTACACTCTGCCATGAATTTAACCAGACGGGA
ATTTCCAGGTTCGAGTTCCACAAAGAACAGTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAATGTCATTTTCCGGCGGGACTCACGACGATCGTTGGGGTTCCGATTTGACTTCCGCCGGAGAATTTACCCAAAGCTTTCCATCGTTTCCAGCAACTTACTCACCTTCCGACGGC
GAAGAGCTCGTAGAAGTAACAATCGAATTCCCAAGCGGCGTACTATTAAACATCGAATCTGTTACCAGCACCGATCCAGAGATTACCTCTTGCTCTGCTTCTGATTCAGGATCAAAATCG
CATAGTTTCGGATGGAGCGCGTCGTCGAGTCGTCGGATCTCAGAGTTTCATACGGTGGAGAAGGCGAAAAAGTTCTCTAGAGATCTGAAAGAAAAGCTTCAAAGGATCTCATTGGGATAT
TCGTCTCGGTCTGCACCGGAGCCGGTGGTTCCTAATGTAGTAGATTTTACGGATCCTGCTGTTCTCTGTCGCTCTTTAACACAACGATTAACAAAGTCTAATGGATCGTGTACAGAGAGA
GCGATTAATGCTTTGAAATTCATAAGCAGCAAAGACAATCGAATCGCTAATTGGAGAGATGTTCAAAACAATTTCGCTAATCTTTCTAAAGATGGTTATCTTTGTCGAAGTGATTTTGCT
AATTGCATAG
GTTTGGAGAATGAAAATTCGAAAGAATTCGCAGATGAGTTGTTCGACGCAATGTGTAGGAGAAGAAGATTAATGGTTGATAAGATCAATCTTCAAGAACTATATGAGTTT
TGGTACCAAATTACTGACGAAAGCTTCGATTCTCGTCTCCAAATCTTCTTCGACAT
GGTTAAAAATGGAGATGGTCGAATCACAGAGAATGAAGTAAAAGAGATCATTATACTAAGTGCA
TCAGCAAATAATCTATTGAGGTTAAGAGAACGAGCAGAGGAATATGCAGCACTGATCATGGAAGAACTTGCACCGGATGGGCTCTATTCTCAGTACATAGAG
TTAAAGGACCTAGAGATG
CTACTACTAGAGAAGGACATATCTCATAGTTACAGCCAACCGTTCAGTCAGACGAGCCGAGCCTTAAGCCAAAACCTAAAGGATACAAGATGGGGAATAAGTAGGAACTTGCTTTACTCT
TTGCAAGACAATTGGAAGAGGATTTGGGTTTTGACATTGTGGTTAGTGATCATGGGCTGGTTGTTTATGTGGAAATGCTATCAGTACAAACGCAAAGACGCATTCCATGTAATGGGTTAC
TGCCTTGTCATGGCGAAAGGTGCAGCTGAGACACTGAAATTCAATATGGCTCTTATCCTTTTGCCGGTCTGTAGAAATACCATCACCTATCTCAGATCCACCGCTTTGTGCCACTCAGTG
CCTTTCGATGACTGCATTAATTTTCACAAG
ACGATCTCTGTAGCAATCATTATTGCAATGCTTCTTCATGCATCCAGCCACCTCGCTTGTGACTTCCCGAGGATTCTAACATCTACTGAG
ACTGATTACAAAAGATACTTGGTTAAGTACTTTGGTATTACCAGACCCACATACTTTGACTTGGTGAATAGTCCTGTAGGAATCACTGGTTTTATAATGGTTGCTTTTATGGTAATTGCA
TTCATATTAGCCAGTCGAAGATGCAGGCGGAACCTTACTAAGTTGCCAAAGCCATTTGACAAACTAACCGGATATAATGCCTTCTGGTATTCACATCACTTACTTCTAACTGTTTACGTC
CTTTTAGTCATCCACGGTGTTTCCCTCTATCTCGAGCATAAATGGTACCGCAAAACG
ATATGGATGTATCTTGCTGTACCAGTTTTACTCTATATTGGTGAAAGGATCCTTAGATTTTTT
CGTTCCAGGCTTTACACCGTTGAAATCTGCAAG
GTTGTAATTTATCCCGGAAACGTTGTTGTACTACGCATGACTAAGCCTACATCATTTGATTACAAGAGCGGACAATATGTATTTGTT
CAGTGTCCTGCAGTGTCAAAATTTGAGTG
GCATCCATTTTCTATTACGTCTTCCCCTGGAGATGATTATCTCAGCATTCACATTCGCCAGCGTGGTGATTGGACAGAAGGGATTAAGAAG
GCATTCTCAGTGGTATGTCAAGCCCCTGAAGCTGGAAAAAGCGGACTTCTCAGAGCAGACGGACCAAACCAAAGAAG
TTTTCCAGAGCTGTTGATAGATGGACCTTATGGCGCTCCAGCG
CAAGACCATTGGAAGTATGATGTGGTACTACTCGTTGGCCTTGGAATCGGCGCAACACCTTTCGTTAGCATTTTGAGAGATCTACTCAACACCATTGTTAAGCAACAAGAACAAGCT
GAA
TGCCTCTCAGGTAGTTGTAGTAACAGCAACATCTCATCTGATCACAGTTTCAGTTGCTTAAACTCGGAAGCTCGGAGTCGGATTCCCCAAACTCAACGGAAGACGTTGAATACTAAGAAC
GCTTACTTTTATTGGGTAACACGAGAACAAGGCTCGTTCGATTGGTTCAAAGATATCATGAACGAAATTGCTGATTCAGATAGAAAG
GGTGTTATTGAGATGCACAACTACTTGACTAGC
GTCTACGAAGAAGGAGATACTCGATCCAATCTTCTCACCATGATCCAAACGCTAAACCACGCTAAAAATGGCGTCGACATATTTTCTGGAACCAAG
GTAAGGACACATTTTGGGAGGCCA
AAATGGAAGAAAGTTTTATCAAAGATTAGCACCAAACATAGGAACGCAAGAATTG
GAGTGTTCTATTGTGGAGTACCGAGTTTGGGGAAGGAACTTTCTACACTCTGCCATGAATTTAAC
CAGACGGGAATTTCCAGGTTCGAGTTCCACAAAGAACAGTTCTAA

Retrieve as FASTA