Entry information : AlyRboh08 (AlyRbohH)
Entry ID 7578
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyRboh08 (AlyRbohH)
Name (synonym) AlyRboh08 (AlyRbohH)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyRboh08
start..stop
S start..stop
AtRboh08 1842 0 1..886 1..886
ThasRboh10 1520 0 5..886 7..900
AlyRboh10 1500 0 1..886 1..912
AtRboh10 1498 0 1..886 1..912
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19358438..19358891 454 N° 2 19359087..19359249 163 N° 3 19359334..19359496 163 N° 4 19359647..19360450 804
N° 5 19360538..19360636 99 N° 6 19360772..19360887 116 N° 7 19360970..19361072 103 N° 8 19361238..19361344 107
N° 9 19361465..19361624 160 N° 10 19361728..19361901 174 N° 11 19362019..19362147 129 N° 12 19362354..19362432 79
N° 13 19362542..19362651 110  
join(19358438..19358891,19359087..19359249,19359334..19359496,19359647..19360450 ,19360538..19360636,19360772..19360887,19360970..19361072,19361238..19361344,193 61465..19361624,19361728..19361901,19362019..19362147,19362354..19362432,1936254 2..19362651)


exon

Literature and cross-references AlyRboh08 (AlyRbohH)
DNA ref. Phytozome 11:   scaffold_8 (19358438..19362651)
Protein sequence: AlyRboh08 (AlyRbohH)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   886
PWM (Da):   %s   100482.43 Transmb domain:   %s   i316-333o400-419i455-477o497-519i692-709o
PI (pH):   %s   9.57
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKNNIPTEDSTKWMLESVEIDSMGEGSSKEPEINLNKNEGGLKKNASRNLGVGSIIRTLSVSNWRKSGNLGSPSTRKSGNLGPPTNAVPKKTGPQRVERTTSSAARGLQSLRFLDRTVTGRERDAWRSIENRFNQFSVDGKLPKEKFGVCIGMGDTMEFAAEVYEALGRRRQIETENGIDKEQLKLFWEDMIKKDLDCRLQIFFDMCDKNGDGKLTEEEVKEVIVLSASANRLGNLKKNAAAYASLIMEELDPDHKGYIMWQLEILLTGMVTNADTEKMKKSQTLTRAMIPERYRTPMSKYVSVTAELMHENWKKLWVLALWAIINVYLFMWKYEEFMRNPLYNITGRCVCAAKGAAETLKLNMALILVPVCRKTLTILRSTFLNRVVPFDDNINFHKVIAYMIAFQSLLHTALHIFCNYPRLSSCSYDVFLTYAGAALGNTQPSYLGLMMTSVSITGVLMIFFMGFSFTLAMHYFRRNIVKLPKPFNVLAGFNAFWYAHHLLVLAYILLIIHGYYLIIEKPWYQKTTWMYLAVPMLFYASERLFSRLLQEHSHRVNVIKAIVYSGNVLALYVTKPPGFRYKSGMYMFVKCPDLSKFEWHPFSITSAPGDDYLSVHIRALGDWTTELRSRFATCEPPQAAAKPKPNSLMRMETRAAGVNPHIEESQVLFPKIFIKGPYGAPAQNYQKFDILLLVGLGIGATPFISILKDMLNHLKPGIPRGQKYEGSVGGESIGGDSVSGGGGKKFPQRAYFFWVTREQASFDWFKGVMDDIAEYDKTHVIEMHNYLTSMYEAGDARSALIAMVQKLQHAKNGVDIVSESRIRTHFARPNWRKVFSELSSKHEACRIGVFYCGSPTLVRPLKELCQEFSLESSTRFTFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 12 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAATAACATTCCTACCGAGGATTCGACAAAATGGATGTTAGAGAGTGTAGAGATCGATTCAATGGGTGAAGGTTCGTCCAAAGAACCCGAAATTAACCTCAACAAGAATGAAGGT
GGTCTGAAGAAGAATGCGTCAAGAAATCTCGGCGTGGGATCGATAATCCGAACGTTAAGCGTTTCAAACTGGAGAAAGAGCGGGAATCTAGGCTCTCCGAGCACAAGGAAAAGTGGGAAC
CTGGGGCCTCCGACCAATGCCGTGCCCAAGAAGACAGGTCCACAAAGAGTGGAGAGGACAACATCTAGCGCCGCTAGGGGACTTCAGAGCTTACGGTTCCTTGATCGGACAGTCACCGGA
CGAGAACGAGATGCATGGAGGTCGATTGAGAATCGATTTAATCAGTTTTCTGTCGATGGCAAATTGCCTAAAGAGAAATTCGGCGTCTGCATTG
GTAATTGATAGAAGTACTAATAGTTT
AAAAGTGTTCCACATATTATATGTCAGATCCTTTTTGATTCATCGTGATTTTTTTTGGAAACGATGACTCTTTTTGACATAGGTATCTTCAAGTTGGATTATTAACGACGATTTTTTTTG
TATTGTTGGTTTAAAAATAAAATTTAACGTTGATGGTATACATTACTAGGAATGGGAGACACGATGGAGTTTGCTGCAGAAGTTTATGAGGCATTGGGTCGGAGAAGACAAATAGAGACA
GAAAACGGTATCGACAAAGAACAACTCAAGCTGTTTTGGGAAGACATGATCAAGAAAGACCTTGATTGTCGTCTTCAGATCTTTTTCGACAT
GTAATTTACTTAATCTTATATGTTTCCA
TATATATACAAGTGCGCTTAATTGATTTAGGCATTATGGTTGTGGTTGTTGTTTAGGTGTGACAAGAACGGAGATGGTAAGCTCACAGAAGAGGAAGTGAAAGAGGTCATAGTCTTGAGC
GCCTCCGCGAACCGCCTAGGGAATTTGAAAAAGAACGCTGCGGCTTACGCGTCTTTGATCATGGAAGAACTCGACCCCGATCACAAAGGATACATAGAG
GTTCACTTTTTCTTTCTATTT
TTAATATCCGTTTGATATAACAGTCGAATATATAATATTCTTTCAAAATTCAAACGATTTTTTTTTATACCTTATCCAGACAAATATAGAGATTTATGTTCTAACCATTTCGTAGTTTAT
ATCTACCAGATGTGGCAGTTAGAGATACTATTAACAGGAATGGTGACAAACGCTGATACAGAGAAGATGAAGAAATCTCAAACGCTGACACGCGCAATGATCCCAGAGCGTTACAGAACG
CCGATGAGCAAATACGTTTCAGTAACCGCAGAACTGATGCACGAGAATTGGAAAAAATTATGGGTACTCGCTTTGTGGGCCATCATCAACGTCTATCTATTCATGTGGAAGTACGAAGAG
TTTATGAGAAACCCTCTCTACAACATCACCGGACGCTGCGTTTGCGCAGCTAAAGGTGCGGCCGAAACGCTGAAACTCAACATGGCTCTGATTTTGGTCCCGGTCTGTAGAAAAACCCTA
ACGATCCTTAGGTCAACGTTTTTGAACCGTGTGGTCCCATTCGACGACAACATAAACTTCCACAAGGTGATTGCGTATATGATCGCGTTCCAGTCTTTGCTTCACACGGCACTTCACATC
TTCTGTAACTACCCTAGGTTAAGCTCGTGCTCTTACGACGTGTTCTTGACGTACGCGGGAGCTGCCTTGGGAAACACGCAACCGAGTTACCTAGGTTTAATGATGACGTCAGTGTCGATC
ACGGGAGTTTTAATGATATTCTTCATGGGATTCTCGTTTACACTGGCCATGCATTATTTTAGAAGGAACATAGTGAAATTGCCTAAACCGTTTAACGTTCTTGCTGGGTTTAATGCGTTT
TGGTATGCTCATCATTTGTTGGTTCTTGCTTATATTCTTCTCATCATCCATGGTTACTATCTTATCATCGAGAAGCCTTGGTACCAGAAGACG
GTAAGTAAGATGTATTTTTTTAATATA
GAATATTTGTGCATTATCATTTTTAAAATCCTTTTTTTTTGTTGGTAAATTGAAATGCAGACATGGATGTATTTGGCCGTGCCGATGCTGTTCTACGCGAGTGAGAGGCTATTCTCACGT
CTCCTTCAAGAACACAGCCATCGTGTCAACGTTATTAAG
GTACTAAAAAAGGCTAATTAATTCATCAAAATATTTACGATAACATTTCGTAATGACTAATTTTGGGCCTATATATAGTAG
TTTTTAATAAATTTGTTTTTTTTTTCCATGTTTTCTGTCACTTTTATTATGTAGGCTATTGTATATTCGGGCAACGTTCTTGCACTTTACGTAACCAAACCTCCAGGGTTCAGATACAAA
AGTGGCATGTACATGTTTGTCAAGTGTCCTGATCTCTCAAAATTTGAATG
GTAATCTAAATAATACTAAATACTTGATTAAAGTTCATACTTTAAGTAACTAGTGATATTTATTTTACTT
TATTATTATTAGGCATCCGTTCTCAATCACTTCTGCACCAGGAGATGATTATTTAAGTGTTCACATTAGAGCCTTGGGAGATTGGACCACTGAACTTAGGAGCAGATTCGCAAAGGTAAT
TGTCACTCTTTATTTTTCTAATTAAAATTTTCACTGTACTTGTAATATTGGTCTTTCATGGTAATTATCCTAGCTAACATAAATCTTATTTTATCAGAGGTTAGAAAACATAAAATTTAA
TTTAAGTGTAAATTATTAAAAAAATTCTGTTTGATTGTAGACATGCGAGCCTCCTCAAGCAGCCGCAAAACCTAAACCAAACAGTCTTATGAGGATGGAAACAAGAGCTGCGGGTGTGAA
TCCTCACATTGAAGAATCACAAGTCTT
GTAAGTGAATACTAAACTAATAACTACCAACTAAATGCATATTATTTTGCAAGAAGATGAGTATGTTCATATAAACGGTGTTTTTAAATTGGA
TCTGATCGAGTCGTTTTTTCGTAACAGATTCCCAAAAATATTCATCAAAGGACCTTATGGAGCTCCGGCACAAAATTATCAGAAGTTCGATATCCTCTTACTAGTTGGACTAGGGATAGG
GGCAACTCCATTCATAAGCATTTTGAAAGACATGTTAAACCATCTAAAACCTGGGATTCCCAGAAGT
GTAAGTAGTATGAACATTTTTGTCTTCATATTTGAGGTTGCATATGAAGGAAA
AGAATCATAATGGGGGTCTACATTTTTTGAATATTGGGAAATATATATAGGGGCAAAAGTACGAAGGAAGTGTAGGAGGAGAGAGTATAGGAGGTGATAGTGTTAGTGGTGGAGGAGGAA
AGAAGTTTCCGCAAAGAGCATATTTTTTTTGGGTGACAAGAGAACAAGCTTCCTTTGATTGGTTCAAGGGAGTTATGGATGACATCGCCGAGTATGATAAAACC
GTAAGTTTATTGATTC
ATTTTACTACATTCTTGTTTTTTTCATAATGGGGTTTATGAATTGCTATAACAAAATAATACGTTTTACAAGTTTCCCAAATAATGTTTTTATTTTGGCAGCATGTGATAGAAATGCATA
ACTACTTAACAAGCATGTACGAAGCGGGAGATGCAAGATCTGCCCTAATCGCCATGGTTCAGAAACTTCAACATGCCAAGAACGGTGTTGATATTGTCTCCGAAAGCCGG
GTAAGTTTTA
GTTAATAACCAAAACCATTATATGAGTTCTCCACTTTAGATTTCGGTTTAAGAACATATTGAATCATTTTGGAGTTAACGTTAAGCACTCCTAAAGGACTTACAAGTATCTTACTTATAT
TAGCACTCCTTAAGGAGTTACAAGTATTTTAATTATATAATTAATTAATCTTATGTATCCTATAAAAACAAATCAGATACGAACACATTTCGCAAGACCTAATTGGAGGAAGGTTTTTTC
TGAGTTATCAAGCAAACACGAAGCTTGTCGAATAG
GTAATTATATATTAAATAGTTATTGTCAACCTTTCTTTTACTCTGTAAACGATCTTAATTTGCTTAAAGCTTTCTACTTTCAAAT
AATTCTTACCTTGTGTATTTTCAGGTGTATTCTACTGTGGAAGTCCAACACTGGTTCGACCACTTAAAGAACTTTGTCAGGAGTTTAGTCTCGAGTCTTCCACTCGTTTTACTTTCCACA
AGGAAAACTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAATAACATTCCTACCGAGGATTCGACAAAATGGATGTTAGAGAGTGTAGAGATCGATTCAATGGGTGAAGGTTCGTCCAAAGAACCCGAAATTAACCTCAACAAGAATGAAGGT
GGTCTGAAGAAGAATGCGTCAAGAAATCTCGGCGTGGGATCGATAATCCGAACGTTAAGCGTTTCAAACTGGAGAAAGAGCGGGAATCTAGGCTCTCCGAGCACAAGGAAAAGTGGGAAC
CTGGGGCCTCCGACCAATGCCGTGCCCAAGAAGACAGGTCCACAAAGAGTGGAGAGGACAACATCTAGCGCCGCTAGGGGACTTCAGAGCTTACGGTTCCTTGATCGGACAGTCACCGGA
CGAGAACGAGATGCATGGAGGTCGATTGAGAATCGATTTAATCAGTTTTCTGTCGATGGCAAATTGCCTAAAGAGAAATTCGGCGTCTGCATTG
GAATGGGAGACACGATGGAGTTTGCT
GCAGAAGTTTATGAGGCATTGGGTCGGAGAAGACAAATAGAGACAGAAAACGGTATCGACAAAGAACAACTCAAGCTGTTTTGGGAAGACATGATCAAGAAAGACCTTGATTGTCGTCTT
CAGATCTTTTTCGACAT
GTGTGACAAGAACGGAGATGGTAAGCTCACAGAAGAGGAAGTGAAAGAGGTCATAGTCTTGAGCGCCTCCGCGAACCGCCTAGGGAATTTGAAAAAGAACGCT
GCGGCTTACGCGTCTTTGATCATGGAAGAACTCGACCCCGATCACAAAGGATACATAGAG
ATGTGGCAGTTAGAGATACTATTAACAGGAATGGTGACAAACGCTGATACAGAGAAGATG
AAGAAATCTCAAACGCTGACACGCGCAATGATCCCAGAGCGTTACAGAACGCCGATGAGCAAATACGTTTCAGTAACCGCAGAACTGATGCACGAGAATTGGAAAAAATTATGGGTACTC
GCTTTGTGGGCCATCATCAACGTCTATCTATTCATGTGGAAGTACGAAGAGTTTATGAGAAACCCTCTCTACAACATCACCGGACGCTGCGTTTGCGCAGCTAAAGGTGCGGCCGAAACG
CTGAAACTCAACATGGCTCTGATTTTGGTCCCGGTCTGTAGAAAAACCCTAACGATCCTTAGGTCAACGTTTTTGAACCGTGTGGTCCCATTCGACGACAACATAAACTTCCACAAGGTG
ATTGCGTATATGATCGCGTTCCAGTCTTTGCTTCACACGGCACTTCACATCTTCTGTAACTACCCTAGGTTAAGCTCGTGCTCTTACGACGTGTTCTTGACGTACGCGGGAGCTGCCTTG
GGAAACACGCAACCGAGTTACCTAGGTTTAATGATGACGTCAGTGTCGATCACGGGAGTTTTAATGATATTCTTCATGGGATTCTCGTTTACACTGGCCATGCATTATTTTAGAAGGAAC
ATAGTGAAATTGCCTAAACCGTTTAACGTTCTTGCTGGGTTTAATGCGTTTTGGTATGCTCATCATTTGTTGGTTCTTGCTTATATTCTTCTCATCATCCATGGTTACTATCTTATCATC
GAGAAGCCTTGGTACCAGAAGACG
ACATGGATGTATTTGGCCGTGCCGATGCTGTTCTACGCGAGTGAGAGGCTATTCTCACGTCTCCTTCAAGAACACAGCCATCGTGTCAACGTTATT
AAG
GCTATTGTATATTCGGGCAACGTTCTTGCACTTTACGTAACCAAACCTCCAGGGTTCAGATACAAAAGTGGCATGTACATGTTTGTCAAGTGTCCTGATCTCTCAAAATTTGAATGG
CATCCGTTCTCAATCACTTCTGCACCAGGAGATGATTATTTAAGTGTTCACATTAGAGCCTTGGGAGATTGGACCACTGAACTTAGGAGCAGATTCGCAAAG
ACATGCGAGCCTCCTCAA
GCAGCCGCAAAACCTAAACCAAACAGTCTTATGAGGATGGAAACAAGAGCTGCGGGTGTGAATCCTCACATTGAAGAATCACAAGTCTT
ATTCCCAAAAATATTCATCAAAGGACCTTAT
GGAGCTCCGGCACAAAATTATCAGAAGTTCGATATCCTCTTACTAGTTGGACTAGGGATAGGGGCAACTCCATTCATAAGCATTTTGAAAGACATGTTAAACCATCTAAAACCTGGGATT
CCCAGAAGT
GGGCAAAAGTACGAAGGAAGTGTAGGAGGAGAGAGTATAGGAGGTGATAGTGTTAGTGGTGGAGGAGGAAAGAAGTTTCCGCAAAGAGCATATTTTTTTTGGGTGACAAGA
GAACAAGCTTCCTTTGATTGGTTCAAGGGAGTTATGGATGACATCGCCGAGTATGATAAAACC
CATGTGATAGAAATGCATAACTACTTAACAAGCATGTACGAAGCGGGAGATGCAAGA
TCTGCCCTAATCGCCATGGTTCAGAAACTTCAACATGCCAAGAACGGTGTTGATATTGTCTCCGAAAGCCGG
ATACGAACACATTTCGCAAGACCTAATTGGAGGAAGGTTTTTTCTGAG
TTATCAAGCAAACACGAAGCTTGTCGAATAG
GTGTATTCTACTGTGGAAGTCCAACACTGGTTCGACCACTTAAAGAACTTTGTCAGGAGTTTAGTCTCGAGTCTTCCACTCGTTTTACT
TTCCACAAGGAAAACTTTTAA

Retrieve as FASTA