Entry information : AlyRboh05 (AlyRbohE)
Entry ID 7579
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-10 (Catherine Mathe)
Peroxidase information: AlyRboh05 (AlyRbohE)
Name (synonym) AlyRboh05 (AlyRbohE)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyRboh05
start..stop
S start..stop
AtRboh05 1756 0 16..925 16..952
ThasRboh05 1376 0 1..925 27..946
VvRboh07 1246 0 4..925 5..917
PtRboh09 1236 0 11..925 18..926
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8134541..8135213 673 N° 2 8135300..8135459 160 N° 3 8136391..8136439 49 N° 4 8136519..8136632 114
N° 5 8136716..8136800 85 N° 6 8136879..8137141 263 N° 7 8137251..8137634 384 N° 8 8137727..8137822 96
N° 9 8137906..8138021 116 N° 10 8138104..8138277 174 N° 11 8138360..8138513 154 N° 12 8138592..8138783 192
N° 13 8138865..8138993 129 N° 14 8139075..8139153 79 N° 15 8139345..8139454 110  
join(8134541..8135213,8135300..8135459,8136391..8136439,8136519..8136632,8136716 ..8136800,8136879..8137141,8137251..8137634,8137727..8137822,8137906..8138021,81 38104..8138277,8138360..8138513,8138592..8138783,8138865..8138993,8139075..81391 53,8139345..8139454)


exon

Literature and cross-references AlyRboh05 (AlyRbohE)
DNA ref. Phytozome 11:   scaffold_1 (8134541..8139454)
Protein sequence: AlyRboh05 (AlyRbohE)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   925
PWM (Da):   %s   104466.15 Transmb domain:   %s   o363-385i504-526o546-568i727-744o
PI (pH):   %s   8.37
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLSPLSFSTSSSFSHADGIDDGVELRSSPFAGGAMLPVFLNGLSRNSGESGSSSWERELVEVTLELDVGDDSILVCGMSEAASVDSRPRSVDLVTARLSRNLSNASTRIRQKLGKLLRSESWKTTTSSTAGERDRDLERQTAETSGIMTARDRRREDAILQRSTSSAQRALKGLQFINKTTRGNSCDCDWDCNCDQMWKKVEKRFESLAKEGLLARDDFGECVGMVDSKEFAVSVFDALARRRRQKLEKITRDELHDFWLQISDQSFDARLQIFFDMADSNEDGKITREEIKLLMLSASANKLAKLKEQAEEYASLIMEELDPENFGYIELWQLETLLLQRDAYMNYSRPLSTTSAGVNNWQRSWVLLLWIMLMAILFVWKFLEYREKAAFKVMGYCLTTAKGAAETLKLNMALVLLPVCRNTLTWLRSTRARACVPFDDNINFHIIACAIAIGILVHAGTHLACDFPRIINSSPEEFALIASAFNGTKPTFKDLMTGAEGITGISMVILTTIAFTLASTHFRRNRVRLPAPLDRLTGFNAFWYTHHLLVVVYIMLIVHGTFLFFADKWYQKTTWMYISVPLVLYVAERSLRACRSKHYSVKILKVSMLPGEVLSLIMSKPPGFKYKSGQYIFLQCPTISRFEWHPFSITSAPGDDQLSVHIRTLGDWTEELRRVLTVGKDLSTCVIGRSKFSAYCNIDTINRPKLLVDGPYGAPAQDYRSYDVLLLIGLGIGATPFISILKDLLNNSRDEQDNEFSRSDFSWNSYTSSYTTTTPTSTHGGKKKAVKAHFYWVTREPGSVEWFRGVMEEISDMDCRGQIELHNYLTSVYDEGDARSTLIKMVQALNHAKHGVDILSGTRVRTHFARPNWKEVFSSIARKHPNSTVGVFYCGIPTVAKELKKQAQDMSQKTTTRFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 14 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTATCGCCTCTGAGTTTCTCTACGAGTTCGAGTTTCAGTCACGCCGATGGAATCGATGACGGTGTTGAGTTAAGATCATCTCCATTTGCCGGCGGCGCAATGCTGCCGGTTTTT
CTCAACGGTTTGAGTCGTAACAGTGGAGAATCCGGAAGTAGTAGCTGGGAAAGAGAGCTCGTGGAGGTGACGTTGGAGCTTGACGTCGGCGATGACTCCATACTCGTTTGCGGAATGTCG
GAGGCGGCGTCTGTTGATTCTCGGCCGAGATCGGTGGATTTAGTAACCGCGAGATTGTCGAGGAATCTATCGAATGCATCTACGAGAATCCGGCAGAAACTGGGGAAATTACTGAGGTCG
GAATCTTGGAAAACGACGACGTCTTCTACCGCCGGCGAGAGAGATAGAGATCTCGAACGTCAGACGGCGGAGACTTCGGGAATTATGACGGCGAGGGATAGACGGAGAGAAGACGCGATA
TTACAGCGATCAACGTCGAGTGCGCAAAGAGCGTTAAAAGGATTACAATTTATCAATAAAACCACGAGAGGAAACAGCTGCGACTGCGATTGGGATTGCAATTGCGATCAGATGTGGAAA
AAAGTTGAGAAACGATTCGAATCGCTTGCTAAAGAAGGACTACTCGCGCGAGACGATTTTGGCGAGTGCGTTG
GTAAGTCAAAGAAAAATCGAATATGGACCAATCCACTCATTGCCAAA
TTAATATAACAAACTATATATGTTTTGAAATTTTTAAAGGGATGGTGGATTCGAAGGAATTCGCGGTCAGTGTATTCGACGCTTTGGCTCGAAGAAGGAGACAGAAACTGGAGAAGATAA
CGAGAGATGAACTTCATGACTTCTGGTTACAGATTTCTGACCAAAGCTTCGACGCCCGTCTTCAAATTTTCTTCGACAT
GTACGTGTCTTTGATTCTCTCTTTCTATTTTATTTTAAAGT
CAAGTTTTGTTTTGTCTTTACGTTTATAACTGTTACGGGAATAACGCATTGCAATTAGCAAAAGCATAAGAAAACAAGTGTATTGATCCAAGTGCAACGAATATTAATCAGTTGACGTTA
ATCATTGAAGAAAACTTTATCTGTAATTGATAATTAGTTTTTTAGTATTCCGAATTCTGAATAATGTAGATGAAGTTTGATCAACTTGCAGTTTTATAAGATTGGACTAATTTTTGTTTT
TTGTGGTATTTTATCAAGTTTAGCTGATTAAATCAAATATTGAGTAAAAAATTAATGTTGTTGATTAAAGATAATGTTAGCTTACCAATCATTTCTTTGATTGGAATTTGTTATCTCTTT
AGTGAGAACTACCGCAACTTCACAATAATTTTCTACAATTTTGGGAATTATTAGGCATAAATTAAAAACATGTGTTGGTTAAGCTGAATTGTGATTGTTTCAAGGCAAATGTTTCACTGA
TATCATATTTTTGTAGAGAGATAGATACATCATTTAAATCACGTGGTGTTTTTAGCCGTTGGATCTGGTAGTTCACGCAATCAACGGTGAAAATGGTCTAATGTGTTTAAAGAATGGGCT
GTAGTTTACTTGGCCCAGTAAAACCAACTTTTACCAAATTTCCAAAAAAGTTTTCTTCTTTCAGCTTTCTCCCCGCAATAAGTTACTTGCAAGTCTTAAACTACACACCAGATGCCAAAA
TGAGTTTTCAATTTTTTTTTGCCAAACATTTAATTCAGTAAAATTATGGTTACTCAATTCATTTCGTTATTCTGTCATTTTTTTTGGTTTAACGATTATACAATTCTGTTATAATTGCAG
TGTTACTAATACAAAAAAGATGCTAATATCTAGTACCGGTTTTGTCACAGGGCTGATAGCAACGAAGATGGGAAGATCACTAGAGAAGAAATCAAAGAAGTAACTTTCTTTTTCAACACC
GAAAATTACGTTTGAAACAATCATATGTCTCTAACAACTCTTATGATTTGAAACGCAGCTTTTGATGCTAAGTGCATCAGCAAACAAGTTAGCAAAACTCAAGGAACAAGCAGAAGAGTA
CGCATCTCTGATCATGGAAGAACTTGATCCAGAGAATTTTGGATACATTGAG
GTTCAAAACATTATATGTCATCACTCTTCAAACACACTATCGATGATTTTGTTTTGTTTTCTAACCTT
TTTGTGTTGTTTCAGTTATGGCAACTCGAGACACTCTTACTTCAGAGAGACGCATACATGAATTACAGTAGACCGCTTAGCACAACAAGCGCTGGAGTGAGTACACCAAGACGGAATCTA
ATCAGACCTCGTCATGTGGTTCGAAAATGTAGAAAAAAACTTCAGTGTCTGGTTCTAGATAACTGGCAAAGAAGCTGGGTTCTTTTGCTGTGGATCATGCTTATGGCCATCCTATTCGTC
TGGAAGTTTCTTGAGTACAGAGAGAAAGCTGCGTTTAAGGTCATGGGGTATTGTTTAACCACTGCTAAAGGAGCTGCAGAGACTCTTAAGCTCAATATGGCTCTGGTTTTATTACCTGTC
TGCAGAAACACATTGACTTGGCTAAGATCTACACGCGCTCGAGCTTGTGTTCCTTTTGATGACAACATCAATTTCCATAAG
GTAAAAGTACAATACAACCTTCCTTCAGTCTTTCGATTT
CTCAGTTTTCATCAATACAACACTTGAGATCAACTCTTTCTCTCTCTCTGTTGTCCCGTTTGTGTGCCAGATTATTGCTTGTGCCATAGCGATTGGGATACTTGTTCATGCTGGTACTCA
TTTGGCGTGTGATTTCCCCCGGATTATAAACTCGAGTCCAGAAGAATTCGCCTTGATTGCTTCTGCCTTCAATGGTACTAAGCCCACATTCAAAGACCTGATGACAGGTGCAGAAGGAAT
CACTGGGATCTCGATGGTGATCTTGACAACCATCGCATTCACATTAGCATCAACTCATTTCAGGAGAAACCGTGTGAGGCTTCCGGCACCACTTGATCGGTTGACTGGCTTTAACGCATT
CTGGTACACTCATCACCTTCTAGTGGTTGTCTACATCATGCTCATTGTCCACGGTACCTTCCTGTTCTTTGCTGATAAGTGGTATCAGAAAACT
GTAAGCATCAGCAAACATAATCGCTC
TTTACTTTAAACCGAAATGCCAAATTTCTAGAAACCTAAATTATTGTTGATTACCGGTGTCCTCAGACTTGGATGTACATCTCGGTTCCTTTGGTGCTCTATGTGGCAGAACGAAGTCTG
CGAGCTTGTAGGTCAAAGCATTACTCTGTCAAAATCCTCAAG
GCAACTACCACAAACCCAGCAAATTCATTCCTGTTAAAAGGTGTTTTAATAACAAAATAGACCTTTCAATATGATCTC
TGCAGGTTTCTATGCTACCTGGAGAAGTACTCAGCTTAATCATGTCAAAGCCTCCTGGATTCAAGTACAAGAGCGGTCAATACATATTCTTGCAGTGTCCAACTATCTCTCGATTTGAAT
G
GTGAGTACTGATACCGACTTCCCATAGTGTTAACAAACATCTCAGGTTCCACTCAAAAAAGATATTCCCTAAACTTTTCCAGGCACCCATTTTCTATTACCTCTGCACCAGGAGATGAC
CAACTTAGTGTTCACATCCGAACACTCGGAGACTGGACAGAGGAGCTACGACGAGTTCTAACTGTGGGCAAAGATCTTTCAACATGCGTGATTGGGCGTTCAAAATTCTCTGCCTATTGC
AATATTGATACAATAAA
GTATATTTCCAGACACCTTTGCTTTCTCTTTTCTACACTTGGAAACCTAGTATTAACATGCTTGTTGATCTTGCATTGGCAGCCGACCGAAATTACTAGTAGA
CGGCCCATATGGAGCTCCAGCACAGGACTACAGAAGCTATGATGTCTTACTCCTCATTGGATTGGGAATAGGAGCTACTCCTTTCATAAGTATCCTGAAGGATCTCCTGAACAATTCAAG
AGACGAACAAACA
GTAAGTCCAATTCAGTGCACCAGAAAAGTTAGTCTTTTCAAGAACCAAATACATATCTCTTAACTTTCAATGGCACAGGACAATGAATTCAGCAGATCGGATTTCAG
CTGGAATAGCTATACCTCTTCATATACCACAACAACCCCAACTTCAACACATGGAGGGAAAAAGAAAGCAGTGAAGGCTCACTTTTACTGGGTCACAAGGGAGCCAGGATCCGTTGAATG
GTTTAGAGGAGTAATGGAAGAAATATCAGACATGGACTGCAGA
GTAATAACACCAGCATATCATTCATTTTCATCACCACTTTAACGTTGATCGATATTCTAACATACTCATCTCGTAAT
ACAGGGCCAGATTGAGTTGCACAACTACCTTACAAGCGTATATGATGAAGGTGATGCAAGATCAACCCTGATAAAAATGGTTCAGGCTTTGAACCATGCCAAACATGGAGTTGATATTCT
ATCCGGAACACGG
GTAAGAACTGTTGCAGGGCATATAACCAGAAACTATTTCCCAATACTACCTATAACTGACAAGATAACATCATTCCAACAGGTGAGAACACATTTTGCAAGGCCCAA
CTGGAAGGAAGTCTTCAGTAGCATAGCAAGAAAGCATCCAAATTCGACAGTCG
GTAAATATTCTATACAATCAGCTGCTTACCAACAAGACATCTGATAAACCTCTCTTCTAGGACTAAT
GAATTAGTACCATTGGAAAAGAAAGAAAATTTAGCAATAAGAATTAATGACACAGGCAAACACATGAACCTATTTAGGCCAGGTATTACGAAGGATATGTGAAAACCATTTATTAACTGT
GCAGGCGTGTTTTACTGCGGCATACCAACCGTGGCAAAGGAGTTGAAGAAGCAAGCACAAGACATGAGTCAAAAAACAACCACACGGTTCGAATTCCATAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTATCGCCTCTGAGTTTCTCTACGAGTTCGAGTTTCAGTCACGCCGATGGAATCGATGACGGTGTTGAGTTAAGATCATCTCCATTTGCCGGCGGCGCAATGCTGCCGGTTTTT
CTCAACGGTTTGAGTCGTAACAGTGGAGAATCCGGAAGTAGTAGCTGGGAAAGAGAGCTCGTGGAGGTGACGTTGGAGCTTGACGTCGGCGATGACTCCATACTCGTTTGCGGAATGTCG
GAGGCGGCGTCTGTTGATTCTCGGCCGAGATCGGTGGATTTAGTAACCGCGAGATTGTCGAGGAATCTATCGAATGCATCTACGAGAATCCGGCAGAAACTGGGGAAATTACTGAGGTCG
GAATCTTGGAAAACGACGACGTCTTCTACCGCCGGCGAGAGAGATAGAGATCTCGAACGTCAGACGGCGGAGACTTCGGGAATTATGACGGCGAGGGATAGACGGAGAGAAGACGCGATA
TTACAGCGATCAACGTCGAGTGCGCAAAGAGCGTTAAAAGGATTACAATTTATCAATAAAACCACGAGAGGAAACAGCTGCGACTGCGATTGGGATTGCAATTGCGATCAGATGTGGAAA
AAAGTTGAGAAACGATTCGAATCGCTTGCTAAAGAAGGACTACTCGCGCGAGACGATTTTGGCGAGTGCGTTG
GGATGGTGGATTCGAAGGAATTCGCGGTCAGTGTATTCGACGCTTTG
GCTCGAAGAAGGAGACAGAAACTGGAGAAGATAACGAGAGATGAACTTCATGACTTCTGGTTACAGATTTCTGACCAAAGCTTCGACGCCCGTCTTCAAATTTTCTTCGACAT
GGCTGAT
AGCAACGAAGATGGGAAGATCACTAGAGAAGAAATCAAAGAA
CTTTTGATGCTAAGTGCATCAGCAAACAAGTTAGCAAAACTCAAGGAACAAGCAGAAGAGTACGCATCTCTGATCATG
GAAGAACTTGATCCAGAGAATTTTGGATACATTGAG
TTATGGCAACTCGAGACACTCTTACTTCAGAGAGACGCATACATGAATTACAGTAGACCGCTTAGCACAACAAGCGCTGGAGTG
A
ATAACTGGCAAAGAAGCTGGGTTCTTTTGCTGTGGATCATGCTTATGGCCATCCTATTCGTCTGGAAGTTTCTTGAGTACAGAGAGAAAGCTGCGTTTAAGGTCATGGGGTATTGTTTA
ACCACTGCTAAAGGAGCTGCAGAGACTCTTAAGCTCAATATGGCTCTGGTTTTATTACCTGTCTGCAGAAACACATTGACTTGGCTAAGATCTACACGCGCTCGAGCTTGTGTTCCTTTT
GATGACAACATCAATTTCCATAAG
ATTATTGCTTGTGCCATAGCGATTGGGATACTTGTTCATGCTGGTACTCATTTGGCGTGTGATTTCCCCCGGATTATAAACTCGAGTCCAGAAGAA
TTCGCCTTGATTGCTTCTGCCTTCAATGGTACTAAGCCCACATTCAAAGACCTGATGACAGGTGCAGAAGGAATCACTGGGATCTCGATGGTGATCTTGACAACCATCGCATTCACATTA
GCATCAACTCATTTCAGGAGAAACCGTGTGAGGCTTCCGGCACCACTTGATCGGTTGACTGGCTTTAACGCATTCTGGTACACTCATCACCTTCTAGTGGTTGTCTACATCATGCTCATT
GTCCACGGTACCTTCCTGTTCTTTGCTGATAAGTGGTATCAGAAAACT
ACTTGGATGTACATCTCGGTTCCTTTGGTGCTCTATGTGGCAGAACGAAGTCTGCGAGCTTGTAGGTCAAAG
CATTACTCTGTCAAAATCCTCAAG
GTTTCTATGCTACCTGGAGAAGTACTCAGCTTAATCATGTCAAAGCCTCCTGGATTCAAGTACAAGAGCGGTCAATACATATTCTTGCAGTGTCCA
ACTATCTCTCGATTTGAATG
GCACCCATTTTCTATTACCTCTGCACCAGGAGATGACCAACTTAGTGTTCACATCCGAACACTCGGAGACTGGACAGAGGAGCTACGACGAGTTCTAACT
GTGGGCAAAGATCTTTCAACATGCGTGATTGGGCGTTCAAAATTCTCTGCCTATTGCAATATTGATACAATAAA
CCGACCGAAATTACTAGTAGACGGCCCATATGGAGCTCCAGCACAG
GACTACAGAAGCTATGATGTCTTACTCCTCATTGGATTGGGAATAGGAGCTACTCCTTTCATAAGTATCCTGAAGGATCTCCTGAACAATTCAAGAGACGAACAAACA
GACAATGAATTC
AGCAGATCGGATTTCAGCTGGAATAGCTATACCTCTTCATATACCACAACAACCCCAACTTCAACACATGGAGGGAAAAAGAAAGCAGTGAAGGCTCACTTTTACTGGGTCACAAGGGAG
CCAGGATCCGTTGAATGGTTTAGAGGAGTAATGGAAGAAATATCAGACATGGACTGCAGA
GGCCAGATTGAGTTGCACAACTACCTTACAAGCGTATATGATGAAGGTGATGCAAGATCA
ACCCTGATAAAAATGGTTCAGGCTTTGAACCATGCCAAACATGGAGTTGATATTCTATCCGGAACACGG
GTGAGAACACATTTTGCAAGGCCCAACTGGAAGGAAGTCTTCAGTAGCATA
GCAAGAAAGCATCCAAATTCGACAGTCG
GCGTGTTTTACTGCGGCATACCAACCGTGGCAAAGGAGTTGAAGAAGCAAGCACAAGACATGAGTCAAAAAACAACCACACGGTTCGAATTC
CATAAGGAGCATTTCTAA

Retrieve as FASTA