Entry information : AlyRboh03 (AlyRbohC)
Entry ID 7580
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyRboh03 (AlyRbohC)
Name (synonym) AlyRboh03 (AlyRbohC)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyRboh03
start..stop
S start..stop
AtRboh03 1855 0 1..906 1..905
ThasRboh03 1565 0 1..906 1..911
PtRboh06 1305 0 12..906 9..909
CclRboh05 1298 0 21..906 26..929
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14319280..14319835 556 N° 2 14319038..14319194 157 N° 3 14318909..14318957 49 N° 4 14318713..14318826 114
N° 5 14318211..14318642 432 N° 6 14317740..14318129 390 N° 7 14317439..14317650 212 N° 8 14317256..14317358 103
N° 9 14317096..14317169 74 N° 10 14315254..14315777 524 N° 11 14315048..14315157 110  
complement(join(14315048..14315157,14315254..14315777,14317096..14317169,1431725 6..14317358,14317439..14317650,14317740..14318129,14318211..14318642,14318713..1 4318826,14318909..14318957,14319038..14319194,14319280..14319835))


exon

Literature and cross-references AlyRboh03 (AlyRbohC)
DNA ref. Phytozome 11:   scaffold_8 (14319835..14315048)
Protein sequence: AlyRboh03 (AlyRbohC)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   906
PWM (Da):   %s   102375.01 Transmb domain:   %s   o353-372i493-515o535-557i718-735o
PI (pH):   %s   9.93
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNRVSFEVSGGYHSDAEAGNSGPMSGGQLPPIYKKPANSRFTAENSQRTRTAAPYVDLTVDVQDDRVSVHSLKMEGGSSVEESPELTLLKRNRLEKKTTVVKRLASVSHELKRLTSVSGSVGGRKPPRPAKLDRTKSAATQALKGLKFISKTDGGAGWSAVEKRFNQITATTGGLLLRTKFGECIGMTSKDFALELFDALARRRNITGEVIDGDQLKEFWEQINDQSFDSRLKTFFDMVDKDADGRLTEDEVRIISLSASANNLSTIQKRADEYAALIMEELDPDNIGYIMLESLETLLLQAATQSVITSTGERKNLSHMMSQRLKPTFNRNPLKRWYRGLRFFVLDNWKRCWVIVLWLIVMAILFTYKYIQYKRSLVYAVMGDCVCMAKGAAETVKLNMALILLPVCRNTITWLRNKTRLGVVVPFDDNLNFHKVIAVGIIVGVTMHAGAHLACDFPRLLHATPEAYRPLRQFFGDEQPKSYWHFVNSVEGITGLVMVLLMAIAFTLATPWFRRGKLNYLPGPLKKLASFNAFWYTHHLFVIVYILLVAHGYYLYLTKDWHNKTTWMYLVAPVILYACERLIRAFRSSIKAVTIRKVAVYPGNVLAIHLSRPQNFKYKSGQYMFVNCAAVSPFEWHPFSITSAPQDDYLSVHIRVLGDWTRALKGVFSVCKPPPAGVSGLLRADMLHGANNPDFPKVLIDGPYGAPAQDYKKYEVVLLVGLGIGATPMISIVKDIVNNIKAKEQAQLNRMENGTSEPQRNKKESFRTRRAYFYWVTREQGSFDWFKNIMNEVAERDTNRIIEMHNYCTSVYEEGDARSALIHMLQSLNHAKNGVDIVSGTRVMSHFAKPNWRNVYKRIAMDHPNSKGVFYCGAPALTKELRHLALDFTHKTSTRFSFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATAGAGTGAGTTTTGAAGTGTCAGGAGGCTATCACTCTGATGCAGAAGCCGGAAACAGCGGTCCAATGAGCGGTGGTCAATTACCACCGATCTATAAAAAGCCGGCGAACTCCAGA
TTCACGGCGGAGAACAGTCAAAGAACACGTACAGCGGCGCCATACGTGGACCTCACGGTAGATGTACAAGACGACAGAGTCTCTGTACACAGCTTGAAAATGGAAGGTGGATCTAGCGTT
GAAGAGAGTCCGGAGCTTACGTTGCTGAAACGGAACCGTCTTGAGAAGAAAACAACGGTGGTGAAACGTTTGGCCTCTGTTTCTCATGAGCTTAAACGCTTGACATCGGTTTCTGGTAGT
GTTGGTGGGAGAAAGCCACCTCGACCGGCTAAGTTAGACCGGACTAAATCCGCCGCAACTCAAGCGTTGAAGGGACTTAAGTTCATTAGTAAAACTGACGGTGGCGCGGGCTGGAGTGCC
GTGGAGAAGAGGTTTAATCAGATCACCGCGACTACCGGTGGACTACTTCTTCGGACAAAGTTCGGTGAATGCATAG
GTAAAGACTAATGTTATAATTTTGAATGTTTTTTTTTTGTAACA
GAATTTGATTTGAAAGTTTGAATGAAAATTTGGTAATGTAGGGATGACTTCAAAGGATTTTGCTTTGGAACTGTTTGATGCATTGGCTAGAAGAAGGAATATAACAGGGGAAGTGATTGA
TGGAGATCAACTAAAGGAGTTTTGGGAACAAATCAATGATCAAAGTTTCGATTCCCGGCTTAAAACATTCTTTGACAT
GTACGGTTTTCGGTTTCCGATTTTTGTTTCTTTTACTTTCTC
TTCTCTAGAATGTGAATTTGAAATTTATGATAATGCAGGGTGGATAAAGATGCTGATGGTAGACTAACAGAAGACGAAGTTAGAGAGGTAAATATACAGAGTTTTATAAGTTATATCTGC
TCTGTTTCAGTGTTAACTCTGTTTCTGATCTTGTTGTTGTGTTTCACAGATTATCAGTCTTAGTGCTTCTGCGAATAATCTATCTACAATCCAGAAGAGAGCTGATGAATATGCAGCACT
GATCATGGAAGAGCTGGATCCAGACAATATTGGATACATCATG
GTAAGTAATTAGCTTGATTTTACCATATTGTGGCTGGAGTCTGAAGCATTTATCGTGAATCTTGAAACAGTTGGAGA
GTCTTGAGACTCTGCTTTTGCAAGCGGCAACACAGTCTGTGATAACAAGTACTGGGGAGAGAAAGAATCTGAGCCATATGATGAGTCAGAGGCTTAAGCCGACGTTTAACCGCAATCCAT
TAAAGCGATGGTACCGTGGCCTTAGATTCTTCGTGTTAGACAACTGGAAAAGATGCTGGGTTATAGTACTATGGCTCATAGTTATGGCTATCCTCTTCACCTACAAATACATCCAGTACA
AGCGTAGCCTGGTGTATGCAGTGATGGGTGATTGTGTATGCATGGCCAAAGGTGCAGCAGAAACAGTTAAGCTGAACATGGCTTTAATTCTCTTACCTGTTTGTAGAAACACCATCACAT
GGCTTAGGAATAAGACCAGGTTGGGTGTTGTTGTCCCATTTGATGATAATCTCAACTTCCACAAG
GTAAACAACAAAAACGAACATATCTTAAAACATGTTCTGTTTCAGGATTTTCTTA
TGATGAAACAATGCTTAAAACATTAGGTTATAGCGGTGGGGATTATAGTTGGAGTAACGATGCACGCCGGGGCACATTTGGCGTGTGACTTCCCGCGGTTACTACACGCAACTCCAGAGG
CATATAGGCCTTTAAGGCAGTTTTTCGGGGATGAGCAACCGAAGAGCTACTGGCATTTTGTAAACTCGGTGGAAGGTATCACCGGACTCGTAATGGTTTTGTTAATGGCAATTGCATTCA
CACTAGCCACGCCATGGTTCAGAAGAGGGAAGCTAAACTATCTTCCAGGACCATTAAAGAAACTAGCTAGCTTCAATGCCTTCTGGTACACTCATCATTTGTTTGTCATAGTCTACATTC
TTCTTGTTGCTCATGGGTACTACTTGTATCTCACCAAAGACTGGCACAACAAGACG
GTACATTAACTTTAATTTAGCTCCTTTGAATCATCACAAGTTACATAAGTTGTTACTAATATAT
CATTTGGTCATGAAAATTGTTGCAGACATGGATGTATTTGGTGGCACCAGTGATTCTATACGCGTGCGAAAGGTTGATAAGAGCATTCAGATCGAGCATCAAGGCGGTGACTATTAGAAA
AGTAGCAGTTTATCCAGGAAACGTGTTGGCAATTCACTTGTCAAGACCTCAAAACTTCAAATACAAGAGCGGTCAATACATGTTTGTTAACTGTGCTGCTGTTTCTCCATTTGAATG
GTA
TGAACCAAACCGATAACTTCATATAGTGCATCGATCCTTACATATACCTAATGAGTGTTCACCATGATGTAATGCAGGCATCCTTTTTCAATCACATCTGCACCACAAGATGATTACCTA
AGTGTTCACATTAGAGTTCTTGGGGATTGGACAAGGGCTCTCAAAGGAGTCTTCTCTGAG
GTTATTACTATAAAGTCTTTAACGAACCAATCTTTTTTGAATTTAAAGAGTTAGATATGA
ATGGTTTGCTTTGTCTGATGTTTCAGGTGTGTAAGCCACCTCCGGCAGGAGTTAGTGGTCTGCTCAGAGCCGACATGTTGCATGGTGCAAATAATCCTGAGTAAGTTAAAATCCTAACCA
CTATATCTTGAAAAATGTGATCCATGCGTCGTTATCTTAATTCTACACGTAAATGACTAAATCATGCTATAGAGAGGATAGGTTCTCGAAGTTTTTTTAGAGGATGAATCGTGAATCGTG
ATATCCACTTAATTAGGAAAAGCATTGTTGAGTATTTTGGTATATAAAGGGTAACAAATTCAAATAATGTACCTAATAGATTATAATAAAGTGGTGTGGGAGACCACAACTAAAACAAAC
TATGTACCTAACCAAATATCACTATTTTATTTAGGTGATTGAGACGCATTATTTGGTTATATATCATGCAAGCACGATGTTTTTGCTTCTCCATGTGACCGCGTAAATCTTTGGGTTGCA
ATATCTTATTTCTCAACTTTTTCCTTAAAAAACATTGCAAGGTGGTCGGATAATTAATTGTGCTAGGTCAATATTCTACGTTTTTTAATAAATATTTTGCATCACGTCAATTATATTGCC
AATATATATGGTTTATTTACTTTATCAAGTTCCCATTTTTTCTAAATAAAAAAAAAAACAATAAAACAGATGCTGACTTTTCAAATGGTCTTCGTAGTTTCCTATCTTGGGTTTGAGCCT
ATCTAACTTTGAGGGCACATCACATGTAGTATAGATCCAGGTGTACGAATATACTTGCATATATACTTCATTAGTTTTGGATAAGTGTGATTATATTATTCTACTCATTTCAGAATTCTA
ACGTGAAATTATTTTTTATAGATTTTTCTTTTGGTGCTAGTAAAAATGATAACTACCTAATCATTATATCATAGTATAGAGTAAGACAAAAAAAACAATGTCACAAGGGAAAGTGAACAT
GACATTCACTAAAAAGAGCTTATATACATAATTAATCAGTAGTCATACTTTTTTTTTTTTAGTCATACTTTTTTTAATCTAACTATATTCAAAGATATTAGATAGGAGATGTGTTTTTAA
TCAAGTGGTTAAGTCCACTTGACTCCGCCTTTTCCATCGGAGTTCGACTCCACTAAGTCGCGTTATTCCGCGTAGTAGGGATTGGCTATGGATCGGGCTTTGTCGATCCAAAGATGTCAA
AAAAAAAAAAAAAAATTAGATATACCGAATTTTGAAAGATCTTAATGTGAATATAATATATAGATATATTTTGATTTTTGACAAAATATTAGTTACGACCAAATTGTTTGATTTCTTTAT
AGGTTTTACCTAGACAATTTCATCTAAGTTAATTTCTTGTTGAGCAATATATAAAAATATAATGACATTTGCTAATGTCAATGTCCCTTATTTCACAGCTTCCCGAAAGTCTTGATCGAT
GGTCCATACGGTGCACCAGCCCAAGACTACAAGAAATACGAGGTGGTTCTACTAGTTGGTCTCGGGATTGGAGCCACACCAATGATCAGTATCGTCAAAGACATTGTTAACAACATCAAG
GCCAAGGAACAAGCCCAACTCAACCGAATGGAGAATGGAACAAGCGAACCACAACGAAATAAGAAAGAGAGTTTCAGGACACGTAGGGCTTACTTCTATTGGGTTACCCGTGAGCAAGGC
TCTTTCGATTGGTTCAAGAACATCATGAACGAAGTCGCGGAACGAGATACCAACCGCATCATCGAGATGCATAATTATTGTACAAGTGTCTATGAAGAAGGAGACGCTCGTTCCGCACTT
ATACATATGCTTCAGTCACTAAACCATGCAAAGAACGGCGTTGACATTGTCTCTGGAACAAGGGTTATGTCCCATTTCGCTAAACCTAATTGGAGAAATGTTTACAAACGTATAGCTATG
GATCACCCTAACTCCAAAGTTG
GTAAGTTCACATCTTTCTTCTCTACTATGCTCGATCGCGGTTATATAGAAATGAAAAGTGATATAGGACTAAAGAATCTTGATTTGGTATGTGCAGGA
GTGTTCTACTGTGGAGCACCAGCATTGACAAAGGAGCTAAGGCATTTAGCTTTAGATTTCACCCACAAGACAAGCACCAGATTCTCCTTCCACAAAGAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATAGAGTGAGTTTTGAAGTGTCAGGAGGCTATCACTCTGATGCAGAAGCCGGAAACAGCGGTCCAATGAGCGGTGGTCAATTACCACCGATCTATAAAAAGCCGGCGAACTCCAGA
TTCACGGCGGAGAACAGTCAAAGAACACGTACAGCGGCGCCATACGTGGACCTCACGGTAGATGTACAAGACGACAGAGTCTCTGTACACAGCTTGAAAATGGAAGGTGGATCTAGCGTT
GAAGAGAGTCCGGAGCTTACGTTGCTGAAACGGAACCGTCTTGAGAAGAAAACAACGGTGGTGAAACGTTTGGCCTCTGTTTCTCATGAGCTTAAACGCTTGACATCGGTTTCTGGTAGT
GTTGGTGGGAGAAAGCCACCTCGACCGGCTAAGTTAGACCGGACTAAATCCGCCGCAACTCAAGCGTTGAAGGGACTTAAGTTCATTAGTAAAACTGACGGTGGCGCGGGCTGGAGTGCC
GTGGAGAAGAGGTTTAATCAGATCACCGCGACTACCGGTGGACTACTTCTTCGGACAAAGTTCGGTGAATGCATAG
GGATGACTTCAAAGGATTTTGCTTTGGAACTGTTTGATGCATTG
GCTAGAAGAAGGAATATAACAGGGGAAGTGATTGATGGAGATCAACTAAAGGAGTTTTGGGAACAAATCAATGATCAAAGTTTCGATTCCCGGCTTAAAACATTCTTTGACAT
GGTGGAT
AAAGATGCTGATGGTAGACTAACAGAAGACGAAGTTAGAGAG
ATTATCAGTCTTAGTGCTTCTGCGAATAATCTATCTACAATCCAGAAGAGAGCTGATGAATATGCAGCACTGATCATG
GAAGAGCTGGATCCAGACAATATTGGATACATCATG
TTGGAGAGTCTTGAGACTCTGCTTTTGCAAGCGGCAACACAGTCTGTGATAACAAGTACTGGGGAGAGAAAGAATCTGAGCCAT
ATGATGAGTCAGAGGCTTAAGCCGACGTTTAACCGCAATCCATTAAAGCGATGGTACCGTGGCCTTAGATTCTTCGTGTTAGACAACTGGAAAAGATGCTGGGTTATAGTACTATGGCTC
ATAGTTATGGCTATCCTCTTCACCTACAAATACATCCAGTACAAGCGTAGCCTGGTGTATGCAGTGATGGGTGATTGTGTATGCATGGCCAAAGGTGCAGCAGAAACAGTTAAGCTGAAC
ATGGCTTTAATTCTCTTACCTGTTTGTAGAAACACCATCACATGGCTTAGGAATAAGACCAGGTTGGGTGTTGTTGTCCCATTTGATGATAATCTCAACTTCCACAAG
GTTATAGCGGTG
GGGATTATAGTTGGAGTAACGATGCACGCCGGGGCACATTTGGCGTGTGACTTCCCGCGGTTACTACACGCAACTCCAGAGGCATATAGGCCTTTAAGGCAGTTTTTCGGGGATGAGCAA
CCGAAGAGCTACTGGCATTTTGTAAACTCGGTGGAAGGTATCACCGGACTCGTAATGGTTTTGTTAATGGCAATTGCATTCACACTAGCCACGCCATGGTTCAGAAGAGGGAAGCTAAAC
TATCTTCCAGGACCATTAAAGAAACTAGCTAGCTTCAATGCCTTCTGGTACACTCATCATTTGTTTGTCATAGTCTACATTCTTCTTGTTGCTCATGGGTACTACTTGTATCTCACCAAA
GACTGGCACAACAAGACG
ACATGGATGTATTTGGTGGCACCAGTGATTCTATACGCGTGCGAAAGGTTGATAAGAGCATTCAGATCGAGCATCAAGGCGGTGACTATTAGAAAAGTAGCA
GTTTATCCAGGAAACGTGTTGGCAATTCACTTGTCAAGACCTCAAAACTTCAAATACAAGAGCGGTCAATACATGTTTGTTAACTGTGCTGCTGTTTCTCCATTTGAATG
GCATCCTTTT
TCAATCACATCTGCACCACAAGATGATTACCTAAGTGTTCACATTAGAGTTCTTGGGGATTGGACAAGGGCTCTCAAAGGAGTCTTCTCTGAG
GTGTGTAAGCCACCTCCGGCAGGAGTT
AGTGGTCTGCTCAGAGCCGACATGTTGCATGGTGCAAATAATCCTGA
CTTCCCGAAAGTCTTGATCGATGGTCCATACGGTGCACCAGCCCAAGACTACAAGAAATACGAGGTGGTTCTA
CTAGTTGGTCTCGGGATTGGAGCCACACCAATGATCAGTATCGTCAAAGACATTGTTAACAACATCAAGGCCAAGGAACAAGCCCAACTCAACCGAATGGAGAATGGAACAAGCGAACCA
CAACGAAATAAGAAAGAGAGTTTCAGGACACGTAGGGCTTACTTCTATTGGGTTACCCGTGAGCAAGGCTCTTTCGATTGGTTCAAGAACATCATGAACGAAGTCGCGGAACGAGATACC
AACCGCATCATCGAGATGCATAATTATTGTACAAGTGTCTATGAAGAAGGAGACGCTCGTTCCGCACTTATACATATGCTTCAGTCACTAAACCATGCAAAGAACGGCGTTGACATTGTC
TCTGGAACAAGGGTTATGTCCCATTTCGCTAAACCTAATTGGAGAAATGTTTACAAACGTATAGCTATGGATCACCCTAACTCCAAAGTTG
GAGTGTTCTACTGTGGAGCACCAGCATTG
ACAAAGGAGCTAAGGCATTTAGCTTTAGATTTCACCCACAAGACAAGCACCAGATTCTCCTTCCACAAAGAGAATTTCTAA

Retrieve as FASTA