Entry information : AlyRboh01 (AlyRbohA)
Entry ID 7581
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Bruno Savelli
Last annotation changes 2015-12-16 (Bruno Savelli)
Peroxidase information: AlyRboh01 (AlyRbohA)
Name (synonym) AlyRboh01 (AlyRbohA)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyRboh01
start..stop
S start..stop
AtRboh01 1748 0 1..897 2..902
ThasRboh01 1330 0 7..897 2..895
CclRboh05 1201 0 26..897 47..929
AlyRboh03 1179 0 19..897 34..906
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2893060..2893582 523 N° 2 2892826..2892982 157 N° 3 2892700..2892748 49 N° 4 2892500..2892613 114
N° 5 2891960..2892385 426 N° 6 2891495..2891881 387 N° 7 2891311..2891406 96 N° 8 2891097..2891212 116
N° 9 2890916..2891018 103 N° 10 2890754..2890827 74 N° 11 2890088..2890626 539 N° 12 2889897..2890006 110
complement(join(2889897..2890006,2890088..2890626,2890754..2890827,2890916..2891 018,2891097..2891212,2891311..2891406,2891495..2891881,2891960..2892385,2892500. .2892613,2892700..2892748,2892826..2892982,2893060..2893582))


exon

Literature and cross-references AlyRboh01 (AlyRbohA)
DNA ref. Phytozome 11:   scaffold_6 (2893582..2889897)
Protein sequence: AlyRboh01 (AlyRbohA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   897
PWM (Da):   %s   102329.57 Transmb domain:   %s   o340-359i479-501o521-543i704-721o
PI (pH):   %s   9.66
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNRSEFQKLGFENVRYYTETPYGGQSSASTSRYYGEDEPYVEITLDIHEDSVSVYGMKSPDHRGAGSIYEDQSLLRQGRSGRSNSVLKRLASSVSTELKRVASSVSSSSARKPPRPQIARLRRSKSRAEQALKGLKFITKTDGVTGWPEVEKRFYVITMTTNGLLHRSKFGECIGMKSTEFALALFDALARRENVSGDLINMNELKEFWKQITDQDFDSRLRTFFAMVDKDSDGRLNEAEVRIITLSASANELDNIRRQAEEYAALIMEELDPYHYGYIMIENLEILLLQAPMPDVRDGESKKLSKMLSQNLMVPQSRNLGARFCRGMKYFLFDNWKRVWVMALWIGAMAGLFTWKFMEYRKRSAYQVMGVCVCIAKGAAETLKLNMAMILLPVCRNTITWLRTKTKLSAIVPFDDSLNFHKVIAIGISIGVGIHATSHLACDFPRLIAADEDEYKPMEMYFGPQTKRYLDFVQSVEGVTGIGMVILMTIAFTLATTWFRRNKLNLPGPLKKITGFNAFWYSHHLFVIVYSLLVVHGFYVYLIIKPWYKKTTWMYLMVPVVLYLFERLIRAFRSSVEAVSVLKVAVLPGNVLSLHLSRPTNFRYKSGQYMYLNCSAVSTLEWHPFSITSAPGDDYLSVHIRVLGDWTKELRSLFSVCKPRPPDENRLNRADSRDWDNIPNFPRILIDGPYGAPAQDYKKFEVLLLVGLGIGATPMISIVKDIINHLKGVEEGSNRRQSPIHNMVTPPVSPSRKSETFITKRAYFYWVTREQGSFDWFKNVMDEVTETDRNKVIELHNYCTSVYEEGDARSALITMLQSLNHAKHGVDVVSGTRVMSHFARPNWRSVFKRIAVNHPKTKGVFYCGAAGLVKELRHLSLDFSHKTSTKFTFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCGAAGTGAGTTTCAAAAGTTAGGATTCGAAAACGTTAGATACTACACAGAGACGCCGTACGGAGGACAGTCGTCGGCGTCGACGAGCAGATATTACGGTGAAGATGAACCATAC
GTTGAGATCACGCTTGATATCCACGAAGATTCTGTCTCCGTGTACGGCATGAAGTCACCGGACCATCGAGGCGCCGGATCGATTTATGAGGATCAATCGCTTCTGAGACAAGGTCGTTCA
GGGAGGAGTAACTCGGTATTGAAACGCTTGGCTTCTTCGGTTTCTACCGAACTGAAACGAGTTGCTTCTTCCGTTTCGTCGTCTTCGGCAAGAAAACCACCGCGGCCGCAGATAGCTAGG
CTGCGCCGTTCGAAATCTAGAGCAGAGCAAGCTCTCAAAGGTCTCAAATTCATCACCAAGACTGATGGTGTCACTGGTTGGCCTGAAGTTGAGAAACGGTTTTATGTGATTACAATGACT
ACGAACGGATTATTACACCGATCTAAATTCGGTGAATGTATAG
GTTAGCAGAAGCGACTAGCAGAGTGTTTCAATGTTTTCTGTTTTGAAATTTCAATGATTACATAAATTCTGTGGCAG

GGATGAAATCGACGGAGTTTGCGTTGGCATTGTTCGATGCTTTAGCGAGGAGGGAGAACGTAAGCGGAGATTTAATAAACATGAATGAGCTTAAAGAGTTCTGGAAGCAGATCACTGATC
AAGATTTTGACTCGAGGCTACGAACTTTCTTCGCAAT
GTAAATGTTTCTTTCGATTTCTTTATATATCCGATATGAACTTTTAGTTTCATATTGAAGTATGGTATGAAATTTAGGGTCGA
TAAGGATTCGGATGGGCGGTTGAATGAAGCAGAAGTAAGAGAG
GTAGAATCTTGATTTTTATAGTGATTGGTATCAGAAATCTTGAAGCTCTTTGTGTCTTCATAAGTAATTTTTCTATT
TGTGTACAGATTATAACTCTAAGTGCTTCTGCAAACGAGCTGGATAACATTCGGAGACAAGCTGAAGAATATGCTGCTTTGATTATGGAAGAACTAGATCCTTATCATTATGGGTACATC
ATG
GTATGTTAAGTTTTGTGAATGAGGTTTGTTTTGATTAATCTTTTTTAGTTAGAAAAGTTTGGTTTGTGAGTGTTTTTTGATGTGTTTGGAGGCACTTGCTACAATGCCAAACAGATA
GAGAATCTCGAGATACTTCTATTGCAAGCGCCGATGCCGGATGTGAGAGATGGGGAGAGTAAGAAGCTGAGCAAGATGCTAAGTCAGAATCTCATGGTTCCGCAGAGTAGGAATCTTGGG
GCTCGTTTTTGCAGAGGGATGAAGTATTTTTTGTTCGATAATTGGAAGAGAGTGTGGGTGATGGCTCTATGGATAGGTGCTATGGCGGGGTTGTTCACGTGGAAGTTTATGGAGTATCGA
AAAAGATCCGCTTACCAAGTTATGGGAGTTTGTGTTTGTATAGCTAAAGGAGCTGCAGAGACGCTTAAACTAAACATGGCTATGATTTTGTTACCAGTTTGTAGGAACACCATCACTTGG
CTCCGGACCAAAACCAAGTTAAGTGCTATTGTTCCTTTCGATGACAGCCTCAATTTTCACAAG
GTAATGTTTTAGCTTCCTGGAGAATAAAAAAGAAGTTTCCGATATATAGAAGAATGC
TTATGATTGAATCTTACACAGGTCATAGCAATAGGAATCTCAATTGGAGTAGGAATCCATGCTACATCTCACTTAGCCTGTGATTTCCCCCGGCTGATAGCTGCAGATGAAGACGAGTAT
AAGCCAATGGAAATGTATTTTGGGCCACAGACAAAGAGATATTTGGACTTTGTGCAATCGGTAGAAGGAGTTACCGGGATTGGAATGGTTATACTAATGACCATAGCCTTTACATTGGCT
ACTACATGGTTCAGACGTAATAAGCTCAACCTTCCTGGACCACTGAAGAAAATAACAGGCTTCAATGCCTTTTGGTACTCTCACCACTTGTTTGTTATCGTCTACTCGCTTCTTGTCGTT
CACGGATTCTACGTATACCTCATCATCAAGCCATGGTACAAGAAAACG
GTTAGTAACTTATTAACCACTAGACCCAATACAAAGTTGTAACAGTTGCAATATGAACTCTGATTTTGTTTT
TCATGTGATTTAATAGACATGGATGTATTTGATGGTACCGGTGGTTCTTTACTTGTTTGAAAGGCTGATTCGTGCATTCAGGTCAAGCGTTGAGGCTGTTTCAGTACTAAAGGTCAAATC
TATAAACATTTCTATATTGAGAATTTGAGATATCCAAGAAAAGGAGGACTTTGTATATTCATCTCTATTACTACCTTACATCTTCGACAGGTTGCTGTGTTACCAGGGAATGTCTTGTCG
CTTCACTTGTCAAGACCAACCAACTTCAGATACAAGAGCGGACAATACATGTATCTCAACTGTTCTGCAGTTTCTACATTAGAATG
GTAAATAAGAAAAACTCTCATATTATCTGAAGAC
ATTTGTATGGAAACAAAACTGAACATTGGTTTACATATAAATAGGCATCCATTCTCAATTACCTCAGCTCCAGGAGATGACTACCTTAGTGTACACATCAGGGTTTTAGGAGACTGGACT
AAGGAATTAAGATCTTTATTCTCTGAG
GTACTTTACTCCATTTTCACTCTAGACATAAACACAAGAGATTAATTGTGTCCAAATATGTAATTTATTGATTTCCTCTTAACCTAAGGTGTG
TAAGCCACGCCCTCCTGATGAAAACAGACTGAACAGAGCCGACTCGAGGGACTGGGATAACATTCCTAA
GTAAGTCTTATCAGTAACTAACTATTCTACAGTTATTCTCTAGCTATTTTA
ATTGCAAATCACTGAAGCACATATTTTAATTCTCTAACTTTGTCATTTTTGCTTTTAAATTGTGATCTCTCCTTAGCTTTCCAAGAATCCTAATCGACGGTCCATATGGAGCACCAGCAC
AAGACTACAAGAAGTTTGAAGTTCTTCTACTAGTGGGTCTAGGAATTGGTGCTACTCCAATGATCAGTATTGTGAAGGACATAATCAATCACTTGAAAGGTGTAGAAGAAGGCAGTAACC
GAAGACAGTCACCGATCCACAATATGGTCACACCTCCTGTTTCTCCATCAAGAAAAAGTGAGACGTTCATAACCAAGAGAGCTTACTTCTACTGGGTCACAAGAGAGCAAGGGTCGTTTG
ACTGGTTCAAGAACGTGATGGACGAAGTGACCGAAACAGACCGAAACAAAGTGATTGAGCTGCATAATTACTGCACTAGCGTCTACGAGGAAGGAGACGCAAGGTCCGCACTAATCACGA
TGCTCCAGTCTCTGAACCATGCTAAGCACGGAGTGGACGTTGTGTCAGGAACACGTGTTATGTCCCATTTCGCTAGGCCAAACTGGAGAAGCGTTTTCAAAAGGATCGCTGTGAATCATC
CCAAGACTAAAGTCG
GTGAGTTTCTTACTAACAAACAATCAATCTCATTTTATTTACGCATATGCACATCATATGAATGTTTGGTAAAATTGGCAGGAGTGTTTTATTGCGGAGCAGCTG
GATTAGTGAAAGAGTTAAGACACTTATCACTGGATTTCTCTCATAAGACCTCTACCAAGTTCACTTTCCATAAAGAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCGAAGTGAGTTTCAAAAGTTAGGATTCGAAAACGTTAGATACTACACAGAGACGCCGTACGGAGGACAGTCGTCGGCGTCGACGAGCAGATATTACGGTGAAGATGAACCATAC
GTTGAGATCACGCTTGATATCCACGAAGATTCTGTCTCCGTGTACGGCATGAAGTCACCGGACCATCGAGGCGCCGGATCGATTTATGAGGATCAATCGCTTCTGAGACAAGGTCGTTCA
GGGAGGAGTAACTCGGTATTGAAACGCTTGGCTTCTTCGGTTTCTACCGAACTGAAACGAGTTGCTTCTTCCGTTTCGTCGTCTTCGGCAAGAAAACCACCGCGGCCGCAGATAGCTAGG
CTGCGCCGTTCGAAATCTAGAGCAGAGCAAGCTCTCAAAGGTCTCAAATTCATCACCAAGACTGATGGTGTCACTGGTTGGCCTGAAGTTGAGAAACGGTTTTATGTGATTACAATGACT
ACGAACGGATTATTACACCGATCTAAATTCGGTGAATGTATAG
GGATGAAATCGACGGAGTTTGCGTTGGCATTGTTCGATGCTTTAGCGAGGAGGGAGAACGTAAGCGGAGATTTAATA
AACATGAATGAGCTTAAAGAGTTCTGGAAGCAGATCACTGATCAAGATTTTGACTCGAGGCTACGAACTTTCTTCGCAAT
GGTCGATAAGGATTCGGATGGGCGGTTGAATGAAGCAGAA
GTAAGAGAG
ATTATAACTCTAAGTGCTTCTGCAAACGAGCTGGATAACATTCGGAGACAAGCTGAAGAATATGCTGCTTTGATTATGGAAGAACTAGATCCTTATCATTATGGGTACATC
ATG
ATAGAGAATCTCGAGATACTTCTATTGCAAGCGCCGATGCCGGATGTGAGAGATGGGGAGAGTAAGAAGCTGAGCAAGATGCTAAGTCAGAATCTCATGGTTCCGCAGAGTAGGAAT
CTTGGGGCTCGTTTTTGCAGAGGGATGAAGTATTTTTTGTTCGATAATTGGAAGAGAGTGTGGGTGATGGCTCTATGGATAGGTGCTATGGCGGGGTTGTTCACGTGGAAGTTTATGGAG
TATCGAAAAAGATCCGCTTACCAAGTTATGGGAGTTTGTGTTTGTATAGCTAAAGGAGCTGCAGAGACGCTTAAACTAAACATGGCTATGATTTTGTTACCAGTTTGTAGGAACACCATC
ACTTGGCTCCGGACCAAAACCAAGTTAAGTGCTATTGTTCCTTTCGATGACAGCCTCAATTTTCACAAG
GTCATAGCAATAGGAATCTCAATTGGAGTAGGAATCCATGCTACATCTCAC
TTAGCCTGTGATTTCCCCCGGCTGATAGCTGCAGATGAAGACGAGTATAAGCCAATGGAAATGTATTTTGGGCCACAGACAAAGAGATATTTGGACTTTGTGCAATCGGTAGAAGGAGTT
ACCGGGATTGGAATGGTTATACTAATGACCATAGCCTTTACATTGGCTACTACATGGTTCAGACGTAATAAGCTCAACCTTCCTGGACCACTGAAGAAAATAACAGGCTTCAATGCCTTT
TGGTACTCTCACCACTTGTTTGTTATCGTCTACTCGCTTCTTGTCGTTCACGGATTCTACGTATACCTCATCATCAAGCCATGGTACAAGAAAACG
ACATGGATGTATTTGATGGTACCG
GTGGTTCTTTACTTGTTTGAAAGGCTGATTCGTGCATTCAGGTCAAGCGTTGAGGCTGTTTCAGTACTAAAG
GTTGCTGTGTTACCAGGGAATGTCTTGTCGCTTCACTTGTCAAGACCA
ACCAACTTCAGATACAAGAGCGGACAATACATGTATCTCAACTGTTCTGCAGTTTCTACATTAGAATG
GCATCCATTCTCAATTACCTCAGCTCCAGGAGATGACTACCTTAGTGTACAC
ATCAGGGTTTTAGGAGACTGGACTAAGGAATTAAGATCTTTATTCTCTGAG
GTGTGTAAGCCACGCCCTCCTGATGAAAACAGACTGAACAGAGCCGACTCGAGGGACTGGGATAACATT
CCTAA
CTTTCCAAGAATCCTAATCGACGGTCCATATGGAGCACCAGCACAAGACTACAAGAAGTTTGAAGTTCTTCTACTAGTGGGTCTAGGAATTGGTGCTACTCCAATGATCAGTATT
GTGAAGGACATAATCAATCACTTGAAAGGTGTAGAAGAAGGCAGTAACCGAAGACAGTCACCGATCCACAATATGGTCACACCTCCTGTTTCTCCATCAAGAAAAAGTGAGACGTTCATA
ACCAAGAGAGCTTACTTCTACTGGGTCACAAGAGAGCAAGGGTCGTTTGACTGGTTCAAGAACGTGATGGACGAAGTGACCGAAACAGACCGAAACAAAGTGATTGAGCTGCATAATTAC
TGCACTAGCGTCTACGAGGAAGGAGACGCAAGGTCCGCACTAATCACGATGCTCCAGTCTCTGAACCATGCTAAGCACGGAGTGGACGTTGTGTCAGGAACACGTGTTATGTCCCATTTC
GCTAGGCCAAACTGGAGAAGCGTTTTCAAAAGGATCGCTGTGAATCATCCCAAGACTAAAGTCG
GAGTGTTTTATTGCGGAGCAGCTGGATTAGTGAAAGAGTTAAGACACTTATCACTG
GATTTCTCTCATAAGACCTCTACCAAGTTCACTTTCCATAAAGAGAATTTCTAA

Retrieve as FASTA