Entry information : AlyRboh06 (AlyRbohF)
Entry ID 7584
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyRboh06 (AlyRbohF)
Name (synonym) AlyRboh06 (AlyRbohF)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyRboh06
start..stop
S start..stop
AtRboh06 1928 0 1..941 1..944
StRboh06 1784 0 1..941 1..944
ThasRboh06 1667 0 1..941 1..949
CclRboh01 1586 0 5..941 4..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 484383..485037 655 N° 2 484155..484314 160 N° 3 483548..483596 49 N° 4 482952..483065 114
N° 5 481856..482278 423 N° 6 480674..481060 387 N° 7 480500..480595 96 N° 8 480285..480400 116
N° 9 480044..480211 168 N° 10 479810..479969 160 N° 11 479544..479723 180 N° 12 479322..479450 129
N° 13 479106..479184 79 N° 14 478784..478893 110  
complement(join(478784..478893,479106..479184,479322..479450,479544..479723,4798 10..479969,480044..480211,480285..480400,480500..480595,480674..481060,481856..4 82278,482952..483065,483548..483596,484155..484314,484383..485037))


exon

Literature and cross-references AlyRboh06 (AlyRbohF)
DNA ref. Phytozome 11:   scaffold_2 (485037..478784)
Protein sequence: AlyRboh06 (AlyRbohF)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   941
PWM (Da):   %s   107943.44 Transmb domain:   %s   o385-404i463-482o523-545i566-588o592-609i745-762o
PI (pH):   %s   9.55
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPFSKNDRRRWSFDSVSAGKTAVGSASTSPGTEYSINGDQEFVEVTIDLQDDDTIVLRSVEPATTAIGDISDDTTGIMTPVSISRSPTMKRTSSNRFRQFSQELKAEAVAKAKQLSQELKRFSWSRSFSGNLTTTSTAANQSGGGGGLVNSALEARALRKQRAQLDRTRSSAQRALRGLRFISNKQTNVDGWNDVQSNFEKFEKNGYIYRSDFAQCIGMKDSKEFALELFDALSRRRRLKVEKINHDELYEYWSQINDESFDSRLQIFFDIVDKNEDGRITEEEVKIIMLSASANKLSRLKEQAEEYAALIMEELDPERLGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRKKSRIHRMSSDFVYFMQENWKRIWVLSLWIMIMIGLFLWKFFQYKQKDAFHVMGYCLLTAKGAAETLKFNMALILFPVCRNTITWLRSTRLSYFVPFDDNINFHKTIAGAIVVAVILHIGDHIACDFPRIVRATEYDYNRYLFHYFQTKQPTYFDLVKGPEGITGILMVILMIISFTLATRWFRRNLVKLPKPFDRLTGFNAFWYSHHLFVIVYILLILHGTFLYFAKPWYVRTTWMYLAVPILLYGGERTLRYFRSGSYSVRLLKVAIYPGNVLTLQMSKPTQFRYKSGQYMFVQCPAVSPFEWHPFSITSAPEDDYVSIHIRQLGDWTQELKRVFSEVCEPPVAGKSGLLRADETTKKSLPKLLIDGPYGAPAQDYRKYDVLLLVGLGIGATPFISILKDLLNNIVKMEEHDSISDFSRSSEHSTGSNGDPPRRKRILKTTNAYFYWVTREQGSFDWFKGVMNEVAELDQRGVIEMHNYLTSVYEEGDARSALITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVLTKLSSKHCNARIGVFYCGVPVLGKELSKLCNTFNQKGSTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 14 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCGTTCTCAAAGAACGATCGGCGACGGTGGTCATTTGATTCAGTTTCCGCCGGAAAAACCGCCGTCGGAAGTGCATCTACTTCACCGGGAACTGAATACTCCATTAACGGTGAT
CAAGAGTTCGTTGAAGTCACAATCGATCTTCAAGACGATGACACAATCGTTCTTCGTAGCGTCGAGCCAGCAACTACCGCCATTGGAGATATCTCCGACGACACAACCGGAATAATGACT
CCGGTTTCGATTTCTAGATCTCCGACGATGAAACGGACTTCATCGAATCGGTTCCGTCAATTCTCTCAAGAGCTTAAGGCGGAAGCTGTGGCCAAGGCGAAACAGTTATCCCAGGAGTTG
AAACGATTCTCGTGGTCTCGTTCTTTTTCAGGCAATTTAACCACCACCAGTACCGCCGCTAATCAAAGCGGCGGCGGTGGTGGTTTGGTAAACTCTGCTTTAGAAGCTCGAGCGTTGCGA
AAACAACGAGCTCAGTTAGATCGGACTCGGTCTAGTGCTCAAAGAGCTCTTCGTGGTTTGAGATTCATCAGCAACAAGCAAACGAACGTTGATGGTTGGAACGATGTTCAATCAAATTTC
GAAAAATTCGAAAAAAATGGTTACATCTATCGCTCCGATTTCGCTCAATGCATAG
GTAAACTCCATAATCTCTAGATTTTGAATTTACTCAAATCTTGATTTGTTTTTTTTTTTTGTTCA
TAGGAATGAAAGATTCTAAAGAATTTGCATTGGAACTGTTCGATGCATTGAGTAGAAGAAGAAGATTAAAAGTTGAGAAAATCAATCACGATGAGCTTTATGAGTATTGGTCACAAATCA
ACGACGAAAGTTTTGATTCTCGTCTCCAGATCTTCTTCGACAT
GTACGTAACAGAAAAGTTACTTACACTTAATAATTAGTTTAATTTTAATTACTGATCTCCTAATCATCTTTTGTTTC
TAATAATAATGATTAGTACTCCCTCCGTTTCATAATATAAGTCGTTTTAGGTTAAAGCACGCGGATTAAGAAGTTCTACTTTTTAAAAATTCAACCAATCATAAAAGAGACTGCATAATA
TAAATAATCATAAAATATTAAAATAATATATAATTTGCATTAAAACTCGAAAACGACTTATATTATGAAACAAATTTTTTTATCTAAAACGCCTTATATTATAAAACGGAGGGAGTATCT
TATAAAGGTTCCTTATAATCATTTTACTATAAGAAAGAACGATCCCATATTTTCAGTGTTCTTAAATAATTAAACAGTGTGGTAATTTAATTTGCATGTGTGGAGAAATTATTGTTCCTT
ACTATGCGTATGTTTTAATTTTTATACTGTATTTTTTTTAATATAAACCTTTTGACTTTAATTGAAGATAATTAATACATAATTAAGAGCTAATCTCCTTTTATTTGTTGGGAATTTACA
GAGTGGACAAGAATGAAGATGGGAGAATTACAGAAGAGGAAGTAAAGGAGGTAAATAAATGATGATAGCTAATCAACACAATTAGCGTTATCAATTTTCATTATTTAATTACATGTCATA
ATTTTATCGTTAAATTTTAAAGTAAAATATAAACTTGGGACTGGTAGTCAAAATATAATTTTATATTTATAATCAAAGTTAGGCGGGGATTTGGTGACCTTAAATCTTATGAAATGCTGA
TATACTAACCACTCCATTTATTTAAAAAAAAAAAATCAAAAGAACCAAAATACGAATTTTCTTGTCTTGATTTTAACCCATGTTCGTTAGATTCCTATCTGTAACTAATTAAGTTGGCAT
TTATGTTGAAATATGTTACTATTGTTTAATTAGTTTTGACTAATAATCAACTTGTTTTAATATAATTTAATCTTTGACGGTGACACAAAATACAATAGAGATGGTTTACTTAACATTTTG
AAGAAAAAATCCTTATTATCGTTTTTTTTTTTTTTTTCTTTGAATATTTTAGATAATAATGTTGAGTGCATCTGCAAATAAGCTATCAAGATTAAAGGAACAAGCAGAGGAATATGCAGC
TTTGATTATGGAAGAGTTAGATCCTGAAAGACTTGGCTACATAGAG
GTTGGTTTTTGATACACTGTACAATCTTTAATATGTTACAAAAAATAAATTAAATTTAAATACATTTCCACAAT
CACATGCTTTGTTTCCGTGCTTGCATGATGTGAATATTATATTATTACAGATTTTTTTTTTTGTTCAACATATTATTGCAGAATTTTTTCAATACTTTCGTTACACAAACGGAATAAAGT
ATGTTAAACCGCCGCCCATAAATGGGAATTCAATTTTTTTATATATAATGTATGACCTCTTTTATCAAAAAAAAAAAAAAAATGTATGACTTCACATGTTATGAGGAAAAAAAGGCCAAT
TTTACAATAGCATTAAATTATTTCATGTTTGCTTTTTTTCTACTCTTATCTCATCTTGCTGACACCTAGTATAGTTGTCCATTATAAAGTATAGATTCTTCTATTCAGTAGTTCAAATAT
AGTATATTTTCTTTTTTTCCAATTCATTTACTTGATGGTAGGTGAAGTAGTTACAATAAACTATTTCAGCTGCTAGCGAAAATAGAAGATAGAGTTTGAAAAAAAAAAACATGTGACTGC
TACATCTTGAATGATATATAATATATTTATCTAACTCATGAGCATGTTAAGATTATGATTCATTAAGGCAAATATTTCACACTTTAATGCTATTTTTTTTGGTTTTTTTTTTTGTGTAGC
TATGGCAACTAGAGACTTTGCTTCTACAAAAAGACACATACCTCAATTACAGTCAAGCATTGAGCTATACAAGCCAAGCATTGAGCCAAAACCTTCAAGGGTTACGAAAAAAGAGTCGAA
TACATCGAATGAGTTCGGATTTCGTATATTTCATGCAAGAGAATTGGAAAAGGATATGGGTTTTATCCTTATGGATCATGATCATGATCGGATTATTCTTATGGAAATTCTTCCAATACA
AGCAAAAAGATGCATTTCATGTGATGGGTTATTGTTTACTCACAGCAAAAGGAGCAGCTGAGACACTTAAATTCAACATGGCTCTAATACTTTTCCCGGTTTGCAGAAACACCATTACCT
GGCTTAGATCCACAAGACTCTCTTACTTCGTTCCTTTTGATGATAATATCAATTTCCACAAG
GTTAGTGAACTATAAACCCTTTTTTGTTGTTTTTTTACTTTGATTTCTACTTTTTAGC
ATTTTTTGGGGGTCCCATAAGAACTTTCTTTTGGTGCTTCTATAGAAGTCAAAACCAATACTAATTAGAGAGATACAAAATCCTCATCGAACGCAATGTGCTGTCGAAAAAGCTGAGATT
GTTGTGGGGCTCATTTTCTTTGTGCACGCACTGGAACATTGACATGACAGCTAAACAACGCTTTCTCCTCTTTTTTTTTCTTCTTCTCATTTCTTACATTTTTTTGCAAAAAAGAAAAGT
GAATAAGAAGAGTAAGCCATGTGAATTTTTGGTTCGGTTATACCGAATTCAGTTTGAAATTCTTTCATCTCGATTTTGCAATAAAAAGACAACCTCCTATGCAGTTCTTGAAAGTTTTAT
ATCTATTTTGGACCAAAATTTTGTTCAGTTTGAAAAGAATCAGTTTGGTTCTGTTTTGCAGAAAAGACAACTTCAGGTTCAATTTTATAAAATTAACATTATCTGTTTATTTACATTCTA
TGTAGTACATGAAATTAAATTTGTGTGTAATATTATATTTACAACAGTTTATTGCAGTTTATTTAATTTGGTTTTGTTGCATTAGCTTGGTTTCAGATGGGGTTTTTGGATATTTTTCGG
TTTGGTATTGGTTAAGAAAAAACTTATTTATTTGATATTTTCAACGTTCATAAGCTAAGAAGCCAATGCTCAATTACTACTAATAAAACTATTTTGATGGAAATTTTTAACTCACTACTC
TTTTTTGTTCTGTGCAGACAATTGCCGGAGCCATTGTAGTAGCTGTGATCCTTCATATTGGAGACCATATTGCTTGTGATTTCCCTAGAATTGTTAGAGCCACTGAATACGATTACAATC
GGTATCTGTTTCATTACTTTCAAACAAAACAGCCAACATACTTCGACCTCGTTAAGGGACCTGAAGGAATCACAGGGATTTTAATGGTCATTTTGATGATTATTTCATTCACATTAGCAA
CAAGATGGTTTAGGCGTAACCTCGTCAAGCTTCCTAAGCCATTTGATCGACTTACCGGTTTTAACGCCTTTTGGTATTCGCATCATTTGTTCGTCATTGTTTATATCTTGCTTATCCTTC
ACGGTACCTTCCTCTATTTCGCCAAGCCTTGGTATGTTCGCACG
GTAAGTCTCTATGATCCTAATTCTAAGCTATATACCTAAGTGTTCTTGGTTTTGATTTTGAGATGTTGTGTTTTGC
AGACATGGATGTATCTTGCGGTACCAATTTTACTCTATGGGGGAGAAAGAACACTTAGGTATTTCCGTTCTGGTTCTTATTCGGTTCGACTTCTTAAGGTAAGTGAAAAACAAAAACTAA
AACAGAGGACTCTGTTTTCTTTATTTTTACTCATTGCCTTGTAGAAAAAGCTAACTTCTTTTGATTTTTCCTTCTAGGTTGCTATATATCCCGGTAACGTTCTAACGCTGCAAATGTCGA
AACCAACTCAATTTCGATACAAAAGCGGACAATACATGTTCGTCCAATGCCCTGCAGTTTCGCCATTCGAATG
GTAAAAACTATTCATATCAGTTTTTGATACTAATCAAATAATCTGTC
TTATACTAATTTGTATTTCGGTCTAGGCATCCATTCTCAATTACTTCAGCACCAGAAGATGATTATGTCAGCATTCACATTAGACAACTCGGAGATTGGACTCAAGAACTCAAAAGAGTA
TTCTCTGAAGTTTGTGAGCCACCAGTTGCTGGTAAAAGCGGACTTCTCAGAGCCGACGAAACAACAAAGAAAAG
GTATAACACGAAAACAAAACCATACACTTATAAGTTAACCAAATGC
TGATATGTTTAGTTAAATGTTGTTTCAGTTTGCCAAAGCTATTGATAGATGGACCATACGGTGCACCGGCGCAAGACTATAGGAAATATGATGTTCTCTTGTTAGTTGGTCTTGGCATTG
GTGCAACTCCATTTATCAGTATCTTGAAAGATTTGCTTAACAACATTGTTAAAATGGAAGAGCATGCG
GTAATAAACTAAGTCTTATCTTCTTCTCTTTTGTGCAAACAATTATAATACA
GCTGGAAATCTGATAAATGATTTTACATCTTCAGGATTCGATCTCGGATTTCAGTAGATCATCAGAACACAGTACAGGAAGCAACGGTGACCCGCCAAGACGGAAAAGAATACTAAAAAC
CACAAATGCTTACTTCTACTGGGTCACAAGAGAACAAGGCTCTTTTGATTGGTTCAAAGGTGTCATGAATGAAGTTGCAGAACTTGATCAACGG
GTAAAAAAGAAACTCAAAACATTTCT
TGACACAATCAAAATTTTCCCAAGAAGAATCAAATTGAGAAAATCAAAGTTTTTTTTTATGGATCAGGGTGTGATAGAGATGCATAACTATTTAACAAGTGTGTATGAAGAAGGTGATGC
TCGTTCTGCTCTCATTACAATGGTTCAAGCTCTTAATCATGCCAAAAATGGAGTCGACATTGTCTCTGGCACTAGG
GTACGTTACTTTCTTCTTTTTCACCATAACGAAGTCGTGATTCT
TTTGATAACCCAAAACGGTCCCCCAAAATCTCAATTATGGAAAAATGAACCCACACACAAAGATATGATTCTTAAAAAATCTTCATTTTTCAGGTCAGGACACACTTTGCAAGACCTAAT
TGGAAGAAGGTTCTCACTAAGCTAAGTTCCAAGCATTGCAATGCAAGGATAG
GTAACAATCACTAACCTCCATACATTTCCAATCTTCACAAAAAGTAAAATATTCTTTTAAGATTCAGT
CAATTTAGTCCCCACAATTCATTTTCAGTATCCGTGGGCAATACGTTTCATTTTCATGCTTTATATATAGAAGCTTTCATTTTCTATCACAATCAAGATTCGGGTTTCAATCAAAATGAT
TCTTAAATCTTTGATCTTTTGCAGGAGTGTTTTATTGCGGAGTACCGGTTTTAGGCAAAGAGCTTAGCAAACTCTGCAACACATTCAATCAAAAAGGTTCAACCAAGTTTGAATTTCACA
AGGAGCACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCGTTCTCAAAGAACGATCGGCGACGGTGGTCATTTGATTCAGTTTCCGCCGGAAAAACCGCCGTCGGAAGTGCATCTACTTCACCGGGAACTGAATACTCCATTAACGGTGAT
CAAGAGTTCGTTGAAGTCACAATCGATCTTCAAGACGATGACACAATCGTTCTTCGTAGCGTCGAGCCAGCAACTACCGCCATTGGAGATATCTCCGACGACACAACCGGAATAATGACT
CCGGTTTCGATTTCTAGATCTCCGACGATGAAACGGACTTCATCGAATCGGTTCCGTCAATTCTCTCAAGAGCTTAAGGCGGAAGCTGTGGCCAAGGCGAAACAGTTATCCCAGGAGTTG
AAACGATTCTCGTGGTCTCGTTCTTTTTCAGGCAATTTAACCACCACCAGTACCGCCGCTAATCAAAGCGGCGGCGGTGGTGGTTTGGTAAACTCTGCTTTAGAAGCTCGAGCGTTGCGA
AAACAACGAGCTCAGTTAGATCGGACTCGGTCTAGTGCTCAAAGAGCTCTTCGTGGTTTGAGATTCATCAGCAACAAGCAAACGAACGTTGATGGTTGGAACGATGTTCAATCAAATTTC
GAAAAATTCGAAAAAAATGGTTACATCTATCGCTCCGATTTCGCTCAATGCATAG
GAATGAAAGATTCTAAAGAATTTGCATTGGAACTGTTCGATGCATTGAGTAGAAGAAGAAGATTA
AAAGTTGAGAAAATCAATCACGATGAGCTTTATGAGTATTGGTCACAAATCAACGACGAAAGTTTTGATTCTCGTCTCCAGATCTTCTTCGACAT
AGTGGACAAGAATGAAGATGGGAGA
ATTACAGAAGAGGAAGTAAAGGAG
ATAATAATGTTGAGTGCATCTGCAAATAAGCTATCAAGATTAAAGGAACAAGCAGAGGAATATGCAGCTTTGATTATGGAAGAGTTAGATCCTGAA
AGACTTGGCTACATAGAG
CTATGGCAACTAGAGACTTTGCTTCTACAAAAAGACACATACCTCAATTACAGTCAAGCATTGAGCTATACAAGCCAAGCATTGAGCCAAAACCTTCAAGGG
TTACGAAAAAAGAGTCGAATACATCGAATGAGTTCGGATTTCGTATATTTCATGCAAGAGAATTGGAAAAGGATATGGGTTTTATCCTTATGGATCATGATCATGATCGGATTATTCTTA
TGGAAATTCTTCCAATACAAGCAAAAAGATGCATTTCATGTGATGGGTTATTGTTTACTCACAGCAAAAGGAGCAGCTGAGACACTTAAATTCAACATGGCTCTAATACTTTTCCCGGTT
TGCAGAAACACCATTACCTGGCTTAGATCCACAAGACTCTCTTACTTCGTTCCTTTTGATGATAATATCAATTTCCACAAG
ACAATTGCCGGAGCCATTGTAGTAGCTGTGATCCTTCAT
ATTGGAGACCATATTGCTTGTGATTTCCCTAGAATTGTTAGAGCCACTGAATACGATTACAATCGGTATCTGTTTCATTACTTTCAAACAAAACAGCCAACATACTTCGACCTCGTTAAG
GGACCTGAAGGAATCACAGGGATTTTAATGGTCATTTTGATGATTATTTCATTCACATTAGCAACAAGATGGTTTAGGCGTAACCTCGTCAAGCTTCCTAAGCCATTTGATCGACTTACC
GGTTTTAACGCCTTTTGGTATTCGCATCATTTGTTCGTCATTGTTTATATCTTGCTTATCCTTCACGGTACCTTCCTCTATTTCGCCAAGCCTTGGTATGTTCGCACG
ACATGGATGTAT
CTTGCGGTACCAATTTTACTCTATGGGGGAGAAAGAACACTTAGGTATTTCCGTTCTGGTTCTTATTCGGTTCGACTTCTTAAG
GTTGCTATATATCCCGGTAACGTTCTAACGCTGCAA
ATGTCGAAACCAACTCAATTTCGATACAAAAGCGGACAATACATGTTCGTCCAATGCCCTGCAGTTTCGCCATTCGAATG
GCATCCATTCTCAATTACTTCAGCACCAGAAGATGATTAT
GTCAGCATTCACATTAGACAACTCGGAGATTGGACTCAAGAACTCAAAAGAGTATTCTCTGAAGTTTGTGAGCCACCAGTTGCTGGTAAAAGCGGACTTCTCAGAGCCGACGAAACAACA
AAGAAAAG
TTTGCCAAAGCTATTGATAGATGGACCATACGGTGCACCGGCGCAAGACTATAGGAAATATGATGTTCTCTTGTTAGTTGGTCTTGGCATTGGTGCAACTCCATTTATCAGT
ATCTTGAAAGATTTGCTTAACAACATTGTTAAAATGGAAGAGCATGCG
GATTCGATCTCGGATTTCAGTAGATCATCAGAACACAGTACAGGAAGCAACGGTGACCCGCCAAGACGGAAA
AGAATACTAAAAACCACAAATGCTTACTTCTACTGGGTCACAAGAGAACAAGGCTCTTTTGATTGGTTCAAAGGTGTCATGAATGAAGTTGCAGAACTTGATCAACGG
GGTGTGATAGAG
ATGCATAACTATTTAACAAGTGTGTATGAAGAAGGTGATGCTCGTTCTGCTCTCATTACAATGGTTCAAGCTCTTAATCATGCCAAAAATGGAGTCGACATTGTCTCTGGCACTAGG
GTC
AGGACACACTTTGCAAGACCTAATTGGAAGAAGGTTCTCACTAAGCTAAGTTCCAAGCATTGCAATGCAAGGATAG
GAGTGTTTTATTGCGGAGTACCGGTTTTAGGCAAAGAGCTTAGC
AAACTCTGCAACACATTCAATCAAAAAGGTTCAACCAAGTTTGAATTTCACAAGGAGCACTTCTAA

Retrieve as FASTA