Entry information : AlyRboh07 (AlyRbohG)
Entry ID 7585
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyRboh07 (AlyRbohG)
Name (synonym) AlyRboh07 (AlyRbohG)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyRboh07
start..stop
S start..stop
AtRboh07 1657 0 1..860 1..849
AlyRboh03 1289 0 1..860 1..906
AtRboh03 1284 0 1..860 1..905
ThasRboh03 1283 0 1..860 1..911
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7293806..7294241 436 N° 2 7294320..7294476 157 N° 3 7294591..7294639 49 N° 4 7294891..7295004 114
N° 5 7295092..7295529 438 N° 6 7295754..7296146 393 N° 7 7296221..7296432 212 N° 8 7296517..7296619 103
N° 9 7296732..7296784 53 N° 10 7297766..7298283 518 N° 11 7298630..7298739 110  
join(7293806..7294241,7294320..7294476,7294591..7294639,7294891..7295004,7295092 ..7295529,7295754..7296146,7296221..7296432,7296517..7296619,7296732..7296784,72 97766..7298283,7298630..7298739)


exon

Literature and cross-references AlyRboh07 (AlyRbohG)
DNA ref. Phytozome 11:   scaffold_7 (7293806..7298739)
Protein sequence: AlyRboh07 (AlyRbohG)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   860
PWM (Da):   %s   97537.67 Transmb domain:   %s   o311-333i455-477o499-521i674-691o
PI (pH):   %s   9.59
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQRVSFEVTDTEAEKSSSETVPLSGAGALPSTFKNPAMENVGNAADDGPSVKNNPKLNAQKQNGLVKLLASVSNQLMKCLTLVTRESKTPRLDRSKSTAGQALKGLKLISKTDGNAAWTVVEKRYLKITANTDGLLLRSKFGECIGMNSKEFALELFDALARKSHLKGDVITETELKKFWEQINDKSFDSRLITFFDLMDKDADGRLTEDEVRIINLSSSANHLSCIQKKADEYAAMIMEELDPDHMGYIMMESLKKLLLQAETKSLSTTNSEERKELSDMLSESLKPTRDPNHLRRWYRQLRFFVLDSWQRIWVIALWLAIMAILFAYKYIQYKNRAVYEVLGPCVCLAKGAAETLKLNMALILLPVCRNTITWLRNKTSWLGVFVPFDDNLNFHKVIAVGITIGVGIHSVAHLACDFPRLIAATPAQYMPLEKFFGEEQPKRYLHFVKSTEGITGLVMVLLMVIAFTLAMPWFRRGKLEKKLPGPLKKLASFNAFWYTHHLFVIVYILLVLHGYYLYLSKEWYKKTTWMYLAVPVALYAYERLIRAFRSSIRTVKVLKVAAYPGKVLTLQMSKPTNFKYKSGQYMFVNCPAVSPFEWHPFSITSTPQEDYLSVHIKSLGDWTEAIQGVFSVSKPPPVGDMLHGANSPGFPKIMIDGPYGAPAQDYKKYEVVLLIGLGIGATPMISIIKDIINNTETKEQLSQMEKGAPQEQQVKKETFKTRRAYFYWVTKEQGTFDWFKNVMNEIAERDKSKVIELHNHCTSVYEEGDVRSALIRMLQSLNYAKNGLDIVAGTRVMSHFARPNWKNVYKQIAMDHPGANGVFYCGAPVLTKELRHLALEFTHKTSTRFSFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGAGTTAGCTTTGAAGTGACGGATACAGAGGCGGAGAAGAGCAGCAGCGAGACAGTTCCACTGAGCGGAGCCGGAGCTTTGCCGTCGACCTTCAAAAATCCGGCGATGGAAAAC
GTTGGAAACGCGGCGGATGATGGACCGAGCGTGAAGAACAATCCGAAACTGAATGCGCAGAAACAGAACGGTCTGGTGAAGTTGCTCGCCTCAGTTTCTAACCAGCTCATGAAGTGTTTG
ACATTGGTCACTAGAGAGAGTAAGACACCTCGATTGGACCGGTCGAAGTCAACGGCCGGTCAGGCCTTGAAAGGGCTCAAGCTCATTAGTAAGACCGACGGCAACGCTGCCTGGACGGTC
GTGGAGAAGCGGTACTTGAAGATCACGGCCAATACTGATGGATTGCTGCTTCGGTCAAAATTCGGTGAATGCATAG
GTAAGATTTTGTAAATTCGAGGAATTGTGACAAATATATGATTT
GGATCTAAATTGGAATATCGATGACATTTTGCAGGGATGAACTCAAAAGAATTTGCCTTGGAATTGTTCGACGCATTAGCTAGAAAAAGTCACCTGAAAGGGGATGTGATTACTGAGACC
GAGTTGAAGAAATTTTGGGAACAAATAAATGATAAAAGCTTTGATTCCAGGCTTATCACGTTCTTTGACTT
GTAATTTTTTTTAGTTATTACACATTTGTTCTTTCGTTTTATTTCTCTG
GATCTCTAAACGTTTTGGTAAAATGAATGTAAAGTTTGAGCCAAAGGGGTTTGTTTCAAATGCAGGATGGATAAAGACGCCGATGGTAGACTAACCGAAGATGAAGTTAGAGAGGTAAAA
CTATTTACCAATGAGGTCTTGATTGTTTCAAATGTTGATTTCTGCATTTACATGCAAAAAAATTTCACTGTCACTATTTTTGTGTGTAAATTTTACAGCGACAAAATTTTGCAAGTTCAT
TTAGAAAAAAGAAATGCAAACAAACAATCAATATACATATTTTAATTATTTTCTTTGAAAATCTTAGAAATGTTTAATGGGTGGAAGATTTTTTGAACTGTGCTCTGTATTTTTGGGTTT
CGCAGATCATCAATCTTAGTTCGTCTGCCAACCATCTGTCATGCATCCAGAAAAAGGCAGATGAATATGCAGCAATGATAATGGAAGAGCTTGACCCTGATCATATGGGATACATCATGG
TAAACTAACTTGATGATGGTCTGAAAACCGATATTTTCTTTTTAATATTGCTTCTATTAGTAACTTTTGTGGTGAATTTAAAACAGATGGAGAGTCTTAAGAAATTGCTTCTGCAAGCGG
AAACAAAATCTTTAAGCACAACTAATAGTGAAGAAAGAAAGGAGCTGAGCGATATGCTAAGTGAGAGTCTTAAGCCTACGCGTGACCCTAACCATTTGAGGAGATGGTACCGTCAACTAA
GATTCTTCGTACTGGATAGCTGGCAAAGAATTTGGGTGATAGCGTTATGGCTCGCGATTATGGCCATCCTCTTCGCGTACAAATATATTCAATACAAGAATAGAGCAGTGTATGAAGTCT
TGGGGCCTTGTGTGTGCTTGGCTAAAGGTGCAGCAGAGACGTTGAAGCTAAACATGGCCTTAATTCTGTTACCTGTATGCAGAAATACCATCACATGGCTTAGAAATAAGACTAGCTGGT
TGGGTGTTTTTGTCCCTTTTGATGACAACCTCAATTTTCATAAG
GTAAAACCACACATTTTTCTTGCTATTTTTAACAATTATGGTTGAGGAATCGTCCTATCGCTCGAGGATATGGATC
AAATCATCTATCACACTTTTATGTAGGTCAATATAGACGTTATAAATGAAGAAAAAAACATAGTTCTTACATGCTTCTAAAATTAATAACCTAGTTATAAAAGAACACCGTTATATCATT
TATAGTAACTTCATGCCTCAACCTACAGGTTATAGCGGTGGGAATTACGATAGGAGTAGGCATACACTCGGTGGCCCACTTGGCATGTGATTTTCCACGGCTAATCGCAGCAACTCCAGC
GCAATACATGCCTCTCGAGAAATTCTTCGGGGAGGAGCAACCAAAGAGGTACTTGCATTTTGTGAAGTCAACAGAAGGAATAACAGGGCTTGTAATGGTCCTCTTGATGGTTATTGCTTT
TACACTGGCTATGCCTTGGTTTAGACGAGGGAAGCTAGAAAAAAAGCTTCCAGGGCCACTAAAGAAACTCGCGAGCTTCAACGCCTTCTGGTACACTCACCATTTGTTTGTTATAGTCTA
CATTCTACTTGTCCTTCACGGATACTACTTGTACCTCAGTAAGGAATGGTACAAGAAAACG
GTGAGTATTTGATCAATGTCCAACATTTTTGTATCTTTGAAAAATGGTACTAAGTCGGG
GGGTTTTGTTTGTAGACGTGGATGTACTTGGCAGTACCAGTAGCTCTCTATGCATACGAGAGATTGATACGAGCATTCAGGTCCAGCATCAGGACTGTAAAAGTTCTTAAGGTCGCGGCT
TACCCTGGAAAAGTGTTGACTTTGCAAATGTCAAAGCCTACAAACTTCAAATACAAGAGCGGTCAATACATGTTTGTAAATTGTCCAGCAGTCTCACCGTTTGAGTG
GTACGCCAAAAAC
AAACTTAAAAGAGTAACAACTCTAAACCCATTTCAATATCAATGCATGTGATTGTATACATATCTCTCCAGGCATCCATTTTCAATAACTTCAACACCACAAGAAGACTATCTGAGCGTT
CATATAAAATCACTGGGAGATTGGACAGAGGCTATCCAAGGAGTTTTCTCCGAG
GTATATATATATTATTTACTTCTAAATCTTAGCTTACGAAATTATATCTTTGGTAAGTCTTGGAGT
CGATGAAAGATATATAGTTTGAGAAGCATCTTGTGTTATATTTCAGGTGTCTAAGCCACCTCCGGTCGGAGACATGTTGCATGGTGCAAATAGTCCCGGGTAAGTATAGTCATCGCATAC
GTAAATGAGTGACATTTGATTTGTGGTAAGAAAATATCACGTTTTACTTGTCTTTATAAAACACAATATACAAATAATAACCGCAATGCTATATATGAATTATTAAAAAAAATGCATGTT
GTTGAAAAACGAAAACCATTTATATGTGTATTCAACTATATACAATTAAAAAATCACACTATGAAGTATGAACATGAGTGAGAAAAACATCTATAACTGAATCCCATAAAGATATAGCTA
GTCATACACGCAAACTAAAAAAAATCAATATCAAAACGAGCCATCAACACCTAAATTAGCTAATGTGATATTACATTAGTTAAAAAAGAAAGAAAGCAGAATGCATCTTTCAAGGTCATT
ATATAAATATGTAGAATAACACCTACCTATTCTTGGTCGTCATTTAGACGACTAGGAAACATCATTTGATTAAATAATCATGTTCTCACTGGTTCTCTTTGTTAAGCTATGTTTTTGTCC
GCAAAGTCTTGGATTCCGAAGATCAGCCGGCCAGTCTGGCTTTTCTTAATATATATGTAAAAGTAGACGTCATTTACAACCACTACTACTATAATATGGATATTTATAATATCACATTCT
GTAAATAATATTAAATGTAGAGATATGAATGATATTTAATTTTTAAAAAATCATTTGGTAGATGAAAACTTCAGATGCATGAGGATATATTTTCATTGCGTTTTAAGTTTTCATTTCGTG
TCTGAGTCTTAAAATTATATATAACAACTTTACCTATGCCATATATTCCATCTATTACTCATACACATACATTCACATATATGTATTTCATACATCAAAAAAACATGTGTGGATATAGGG
GAAATTGCATATCAACATATCACATATGTGTGTGTGCGTACACATTCTTTGTTGTTGGAAAATTAATCTACCTAAGATTTTCTAATAATTTTGAAATGGCAATGACCTCTTCTTCCGCAG

TTTTCCCAAAATTATGATTGATGGTCCGTACGGCGCACCAGCTCAAGACTACAAGAAGTACGAGGTGGTTCTGCTGATCGGTCTTGGCATTGGAGCCACCCCGATGATCAGCATTATCAA
GGACATTATCAACAATACGGAGACCAAGGAGCAGCTCAGCCAAATGGAGAAGGGGGCTCCACAGGAGCAACAAGTTAAGAAAGAAACTTTCAAGACGCGAAGGGCTTACTTCTACTGGGT
AACAAAGGAGCAGGGTACATTTGATTGGTTCAAGAACGTCATGAACGAGATTGCAGAACGAGACAAAAGCAAAGTCATAGAACTACACAATCATTGCACTAGTGTCTACGAAGAAGGAGA
CGTTCGTTCCGCACTCATACGGATGCTTCAGTCTCTAAATTATGCCAAGAATGGTTTAGACATTGTTGCTGGGACAAGGGTCATGTCCCATTTCGCCAGACCTAATTGGAAAAATGTTTA
CAAACAGATTGCCATGGATCACCCTGGTGCTAATGTTG
GTAAGCTCGTTATCTCCCTCGTCAAATCAACCAGTAAGCGTATGGTTGTTGTGTTTTGGTTTGGTTGTCAAAAAGTAATATT
ATATCAAGTACAAACCCTTATTAATTGTGATGCTTTGTTATAGGCATGCTTGCATCAACTTGCATGATATTATGATCTTCATATTGCACTATCACAGTCAGTTCATACAAAACAAAATTA
GCTTAGTTTCATAATTTTTACATACAGGTTATAGTAACAAAGGTGTAGAATATGATTTGATATTTTGTTTTTAAAATCATCTTATAATCTATTTAATGACTATAAAGAAATGATATAAAC
TGAAAATGTATACATAACGTGCAGGAGTGTTCTATTGTGGAGCACCGGTATTGACGAAGGAGTTAAGGCATCTAGCTTTGGAATTCACACACAAGACAAGTACTAGATTCTCTTTCCACA
AAGAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGAGTTAGCTTTGAAGTGACGGATACAGAGGCGGAGAAGAGCAGCAGCGAGACAGTTCCACTGAGCGGAGCCGGAGCTTTGCCGTCGACCTTCAAAAATCCGGCGATGGAAAAC
GTTGGAAACGCGGCGGATGATGGACCGAGCGTGAAGAACAATCCGAAACTGAATGCGCAGAAACAGAACGGTCTGGTGAAGTTGCTCGCCTCAGTTTCTAACCAGCTCATGAAGTGTTTG
ACATTGGTCACTAGAGAGAGTAAGACACCTCGATTGGACCGGTCGAAGTCAACGGCCGGTCAGGCCTTGAAAGGGCTCAAGCTCATTAGTAAGACCGACGGCAACGCTGCCTGGACGGTC
GTGGAGAAGCGGTACTTGAAGATCACGGCCAATACTGATGGATTGCTGCTTCGGTCAAAATTCGGTGAATGCATAG
GGATGAACTCAAAAGAATTTGCCTTGGAATTGTTCGACGCATTA
GCTAGAAAAAGTCACCTGAAAGGGGATGTGATTACTGAGACCGAGTTGAAGAAATTTTGGGAACAAATAAATGATAAAAGCTTTGATTCCAGGCTTATCACGTTCTTTGACTT
GATGGAT
AAAGACGCCGATGGTAGACTAACCGAAGATGAAGTTAGAGAG
ATCATCAATCTTAGTTCGTCTGCCAACCATCTGTCATGCATCCAGAAAAAGGCAGATGAATATGCAGCAATGATAATG
GAAGAGCTTGACCCTGATCATATGGGATACATCATG
ATGGAGAGTCTTAAGAAATTGCTTCTGCAAGCGGAAACAAAATCTTTAAGCACAACTAATAGTGAAGAAAGAAAGGAGCTGAGC
GATATGCTAAGTGAGAGTCTTAAGCCTACGCGTGACCCTAACCATTTGAGGAGATGGTACCGTCAACTAAGATTCTTCGTACTGGATAGCTGGCAAAGAATTTGGGTGATAGCGTTATGG
CTCGCGATTATGGCCATCCTCTTCGCGTACAAATATATTCAATACAAGAATAGAGCAGTGTATGAAGTCTTGGGGCCTTGTGTGTGCTTGGCTAAAGGTGCAGCAGAGACGTTGAAGCTA
AACATGGCCTTAATTCTGTTACCTGTATGCAGAAATACCATCACATGGCTTAGAAATAAGACTAGCTGGTTGGGTGTTTTTGTCCCTTTTGATGACAACCTCAATTTTCATAAG
GTTATA
GCGGTGGGAATTACGATAGGAGTAGGCATACACTCGGTGGCCCACTTGGCATGTGATTTTCCACGGCTAATCGCAGCAACTCCAGCGCAATACATGCCTCTCGAGAAATTCTTCGGGGAG
GAGCAACCAAAGAGGTACTTGCATTTTGTGAAGTCAACAGAAGGAATAACAGGGCTTGTAATGGTCCTCTTGATGGTTATTGCTTTTACACTGGCTATGCCTTGGTTTAGACGAGGGAAG
CTAGAAAAAAAGCTTCCAGGGCCACTAAAGAAACTCGCGAGCTTCAACGCCTTCTGGTACACTCACCATTTGTTTGTTATAGTCTACATTCTACTTGTCCTTCACGGATACTACTTGTAC
CTCAGTAAGGAATGGTACAAGAAAACG
ACGTGGATGTACTTGGCAGTACCAGTAGCTCTCTATGCATACGAGAGATTGATACGAGCATTCAGGTCCAGCATCAGGACTGTAAAAGTTCTT
AAGGTCGCGGCTTACCCTGGAAAAGTGTTGACTTTGCAAATGTCAAAGCCTACAAACTTCAAATACAAGAGCGGTCAATACATGTTTGTAAATTGTCCAGCAGTCTCACCGTTTGAGTG
G
CATCCATTTTCAATAACTTCAACACCACAAGAAGACTATCTGAGCGTTCATATAAAATCACTGGGAGATTGGACAGAGGCTATCCAAGGAGTTTTCTCCGAG
GTGTCTAAGCCACCTCCG
GTCGGAGACATGTTGCATGGTGCAAATAGTCCCGG
TTTTCCCAAAATTATGATTGATGGTCCGTACGGCGCACCAGCTCAAGACTACAAGAAGTACGAGGTGGTTCTGCTGATCGGTCTT
GGCATTGGAGCCACCCCGATGATCAGCATTATCAAGGACATTATCAACAATACGGAGACCAAGGAGCAGCTCAGCCAAATGGAGAAGGGGGCTCCACAGGAGCAACAAGTTAAGAAAGAA
ACTTTCAAGACGCGAAGGGCTTACTTCTACTGGGTAACAAAGGAGCAGGGTACATTTGATTGGTTCAAGAACGTCATGAACGAGATTGCAGAACGAGACAAAAGCAAAGTCATAGAACTA
CACAATCATTGCACTAGTGTCTACGAAGAAGGAGACGTTCGTTCCGCACTCATACGGATGCTTCAGTCTCTAAATTATGCCAAGAATGGTTTAGACATTGTTGCTGGGACAAGGGTCATG
TCCCATTTCGCCAGACCTAATTGGAAAAATGTTTACAAACAGATTGCCATGGATCACCCTGGTGCTAATGTTG
GAGTGTTCTATTGTGGAGCACCGGTATTGACGAAGGAGTTAAGGCAT
CTAGCTTTGGAATTCACACACAAGACAAGTACTAGATTCTCTTTCCACAAAGAGAACTTCTAA

Retrieve as FASTA