Entry information : ZmPrx63
Entry ID 759
Creation 2005-12-09 (Christophe Dunand)
Last sequence changes 2005-12-09
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx63
Name ZmPrx63
Class Class III peroxidase    [Orthogroup: Prx085]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx63
start..stop
S start..stop
ZmPrx68 615 0 49..351 29..332
SbPrx35 518 0 49..351 113..413
ZmPrx08 429 1e-151 17..349 16..349
SiPrx116 427 3e-151 50..351 46..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 168791897..168792178 282 N° 2 168792296..168793069 774  
join(168791897..168792178,168792296..168793069)


exon

Literature and cross-references ZmPrx63
Literature Bohnert,H. et al., unpublished
DNA ref. GenBank:   AC206295.2 (8261..9377)
Cluster/Prediction ref. UniGene:   Zm.21449
Protein sequence: ZmPrx63
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (330)
PWM (Da):   %s   36543.17 (34492.0)  
PI (pH):   %s   5.71 (5.35) Peptide Signal:   %s   cut: 22 range:22-351
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATKLAVLGTLVLALLGPVSCQQQQAGYGYGAGSPTPTTSPPPPPPAAGAGLSVGYYKDKCAEAETIVQEAVRAADAGTKAGLLRLFFHDCFVQGCDASVLLKPDNDTNPQPEMLGVPNLSLRGFEVIDAAKAAVEARCPGVVSCADIVAFAGRDASAFLSGGAINFTMPAGRYDGTVSLANETLPNLPPPFADVRRLKAMFAAKGLDTVDMVALSGAHSIGRSHCSSFSSDRLPPSNTSDMDPAFAATLQASCASSANGAADNTVVQDYRTPDQLDNQYYRNVISHKVLFASDAALLKSSDTLGLVYVAAFSQKLWQDKFGEAMVKMGGVQVKTAANGEIRRMCGYVNKP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, intron 1) and 6 ESTs. Contig contains 6 other peroxidases.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCAAGCTCGCCGTTCTCGGCACCTTGGTGCTCGCGCTGCTCGGCCCCGTGTCGTGCCAACAACAGCAAGCGGGCTACGGCTATGGCGCCGGCAGTCCTACACCTACTACATCG
CCGCCGCCGCCGCCACCTGCCGCTGGTGCCGGACTGAGCGTAGGATACTACAAGGACAAGTGCGCCGAGGCAGAAACCATCGTGCAGGAGGCCGTGCGCGCTGCCGACGCCGGCACCAAA
GCAGGGCTCCTCCGTTTGTTCTTCCACGACTGCTTCGTCCAG
GTATTATATACTCCGTACTATAAACCATGCATGTGACTATGTGAGTGTGACACCCTCGTCGTGTGACGTGTCTGCATG
TGTCCAACAATGTGTCGTACTTACGTATGGCGTTCACAGGGCTGCGACGCCTCCGTTCTGCTCAAGCCCGACAACGACACCAACCCGCAGCCGGAGATGCTCGGGGTCCCCAACCTGAGC
CTGCGCGGCTTCGAGGTCATCGACGCGGCCAAGGCGGCGGTCGAGGCGAGATGCCCGGGCGTCGTGTCCTGCGCCGACATCGTCGCCTTCGCCGGCCGCGACGCCAGCGCGTTCCTCAGC
GGCGGCGCCATCAACTTCACCATGCCCGCGGGCCGCTACGACGGGACGGTGTCGCTCGCCAACGAGACGCTCCCCAACCTGCCCCCGCCGTTCGCCGACGTCCGGCGCCTCAAGGCCATG
TTCGCCGCCAAGGGCCTCGACACCGTCGACATGGTCGCGCTCTCCGGCGCGCACAGCATCGGCCGCTCCCACTGCTCCTCCTTCAGCAGCGACCGCCTCCCGCCCAGCAACACCTCCGAC
ATGGACCCGGCGTTCGCCGCCACGCTGCAGGCGAGCTGCGCGTCGTCGGCCAACGGCGCTGCCGACAACACGGTGGTGCAGGACTACAGGACCCCTGACCAGCTGGACAACCAGTACTAC
CGGAACGTCATCAGCCACAAGGTGCTCTTCGCGTCGGATGCCGCACTCCTCAAGTCAAGCGACACGCTTGGGCTGGTCTATGTAGCCGCCTTCTCTCAGAAGCTGTGGCAGGACAAGTTT
GGAGAAGCCATGGTGAAGATGGGTGGCGTCCAGGTGAAGACGGCCGCCAATGGGGAGATCAGACGGATGTGTGGCTACGTCAACAAACCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCAAGCTCGCCGTTCTCGGCACCTTGGTGCTCGCGCTGCTCGGCCCCGTGTCGTGCCAACAACAGCAAGCGGGCTACGGCTATGGCGCCGGCAGTCCTACACCTACTACATCG
CCGCCGCCGCCGCCACCTGCCGCTGGTGCCGGACTGAGCGTAGGATACTACAAGGACAAGTGCGCCGAGGCAGAAACCATCGTGCAGGAGGCCGTGCGCGCTGCCGACGCCGGCACCAAA
GCAGGGCTCCTCCGTTTGTTCTTCCACGACTGCTTCGTCCAG
GGCTGCGACGCCTCCGTTCTGCTCAAGCCCGACAACGACACCAACCCGCAGCCGGAGATGCTCGGGGTCCCCAACCTG
AGCCTGCGCGGCTTCGAGGTCATCGACGCGGCCAAGGCGGCGGTCGAGGCGAGATGCCCGGGCGTCGTGTCCTGCGCCGACATCGTCGCCTTCGCCGGCCGCGACGCCAGCGCGTTCCTC
AGCGGCGGCGCCATCAACTTCACCATGCCCGCGGGCCGCTACGACGGGACGGTGTCGCTCGCCAACGAGACGCTCCCCAACCTGCCCCCGCCGTTCGCCGACGTCCGGCGCCTCAAGGCC
ATGTTCGCCGCCAAGGGCCTCGACACCGTCGACATGGTCGCGCTCTCCGGCGCGCACAGCATCGGCCGCTCCCACTGCTCCTCCTTCAGCAGCGACCGCCTCCCGCCCAGCAACACCTCC
GACATGGACCCGGCGTTCGCCGCCACGCTGCAGGCGAGCTGCGCGTCGTCGGCCAACGGCGCTGCCGACAACACGGTGGTGCAGGACTACAGGACCCCTGACCAGCTGGACAACCAGTAC
TACCGGAACGTCATCAGCCACAAGGTGCTCTTCGCGTCGGATGCCGCACTCCTCAAGTCAAGCGACACGCTTGGGCTGGTCTATGTAGCCGCCTTCTCTCAGAAGCTGTGGCAGGACAAG
TTTGGAGAAGCCATGGTGAAGATGGGTGGCGTCCAGGTGAAGACGGCCGCCAATGGGGAGATCAGACGGATGTGTGGCTACGTCAACAAACCCTAA

Retrieve as FASTA