Entry information : AbLDS01_bisporus
Entry ID 7597
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-10 (Catherine Mathe)
Peroxidase information: AbLDS01_bisporus
Name AbLDS01_bisporus
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbLDS01_bisporus
start..stop
S start..stop
AbLDS01_burnettii 2229 0 1..1086 1..1086
LbiLDS01 1056 0 10..1082 9..1070
CcinLDS01 955 0 4..1084 1..1088
JargLDS01 944 0 5..1081 3..1066
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 519556..519729 174 N° 2 519443..519505 63 N° 3 519303..519390 88 N° 4 518683..519251 569
N° 5 518478..518631 154 N° 6 518360..518424 65 N° 7 518059..518306 248 N° 8 517838..518006 169
N° 9 517748..517781 34 N° 10 517467..517697 231 N° 11 517041..517417 377 N° 12 516797..516988 192
N° 13 516539..516745 207 N° 14 516188..516487 300 N° 15 516038..516136 99 N° 16 515806..515987 182
N° 17 515642..515750 109  
complement(join(515642..515750,515806..515987,516038..516136,516188..516487,5165 39..516745,516797..516988,517041..517417,517467..517697,517748..517781,517838..5 18006,518059..518306,518360..518424,518478..518631,518683..519251,519303..519390 ,519443..519505,519556..519729))


exon

Literature and cross-references AbLDS01_bisporus
DNA ref. JGI genome:   scaffold_12 (519729..515642)
Cluster/Prediction ref. JGI gene:   195360
Protein sequence: AbLDS01_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1086
PWM (Da):   %s   120959.15  
PI (pH):   %s   6.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSHLTNLLLKLARDADFSAASRAPLDTDGAHPNTHAAEATVAQIIDFCTNPPVSLSDSGAYWDLIKNGNSVGMDDRKMLLERLLEAMARLSDQNHGASLKIQQLVIGILYKDLPHPPHGFLSPFDTSKELYLSSRPDAKTSPTMPKDVQYAYRAADGSNYNPFIPGIGKAGSPYARTVPSTNLTPVSTLPDAGLVFDVLLKRDKFTPHPDGISSFFFAMADLIIHCIFNTSREDWTINNASSYLDLSILYGSSDDEIKTVRSFDGRGGLMPDCFADGRLLGMPPASCALLVLLNRNHYIAQRIFDINECGRFQDPSSLSPELKSVQDDEIFHRTRLVNCGYFMNIILGDYVGAILGLVRDGNDWRLDPLNMRGLEHEVSTRGEGNVCSVEFNLLYRWHTTLSERNVEWLEDELAKFLPPDADPSNVADFKTAARAFQGKSKGLPPSKWTFGGLSRGTSGRFKDSDLAKVIQEATHDVAGAYKARGIPAAMKAIEVMGIIRSRQWGVCLNEFRKFMGLKPYQSFREWNPDPEIYNAAAALYKNIDRLELHVGLQAEEPKLPGPGAGLCPGFTISRAILSDAVCLTRGDRFLTTDFTPFNLTAWGYQDCQFDKENGSYGGMLTKLLFRTLPDQYPAGSVLAHFPFNIPTKMHDVLAARNDGSLQRYRWPTELDRTNPLPPLKDDYERKVVNDLAAVKQALIVDAAKFVSNVTERKKKVVGSTGRHITHVKEAILNGNKWAEYFKTKTEYLLKNKTLEGVGSSGLCYVDIVQDVINLLPLYWICEEVAELPLKSASNPWGAWYEQETCDKFADIAQYIYSTFEPVDDFKLQTRSKKYAAEIIQFITETLDSQASTVGRIFEQMKALQKNDDNKVLRSLKDESGDAAHTTVANDIFDAAVPTAALFSKAIVHAVDYFLDDANKQARGEIVNLFSSQRPDSSAQIMGYVREALRLNPIFTGVYQTCLQPIVLQNQRIEANDQVFVDIFRANSSLGSRPNYSRPVHDQGIWSPYQEGMMTPKFFDTVVPAIVGTILSQKGLKRADGESGRLTKFDENWHGTPRRQYLDISGLVTPWPDTMIVQLQVKV

Retrieve as FASTA  
Remarks Complete sequence from genomic (16 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCCACTTGACAAATCTACTTCTCAAACTCGCTAGAGACGCTGACTTTAGCGCCGCCTCGCGTGCACCGCTCGATACCGACGGTGCGCACCCCAATACGCACGCCGCGGAAGCGACG
GTCGCTCAGATCATCGACTTCTGTACCAACCCTCCCGTCAGCCTATCTGATTCG
GTATGTCCCGTTTGTCCTTGCTGCAATGCTTGCCGTTTATCTTTCTTTAGGGCGCATATTGGGATC
TTATCAAGAATGGCAACTCGGTTGGCATGGACGACCGAAAAATGCTT
GTATGCTGTCTTTCCATGTATTATAACGTTCTTACCGCTCATATCTACCTAGTTGGAGAGACTGTTGGAAGCG
ATGGCGCGTCTCAGCGATCAGAATCATGGCGCCTCTCTCAAAATACAACAGCTAGTGATCGGTATTC
GTACGTTGCTTGTATGCGAATTTGTCAACTGCTTCTAATCGGCTACTGCAGTT
TACAAAGACTTACCACACCCACCTCATGGCTTCCTTAGCCCATTCGACACTTCAAAGGAACTCTATTTATCCTCCCGCCCTGATGCCAAAACTTCGCCCACAATGCCCAAAGACGTACAG
TATGCCTATCGAGCTGCAGATGGCTCTAATTATAATCCCTTCATACCTGGCATCGGGAAAGCTGGCTCACCATATGCACGCACTGTTCCTTCCACAAATCTCACCCCAGTCTCCACCCTT
CCGGATGCTGGGCTTGTTTTCGATGTGCTTCTGAAACGAGACAAATTCACCCCTCATCCTGATGGCATTTCTTCTTTCTTCTTCGCAATGGCGGATTTGATTATTCATTGCATATTCAAT
ACCAGTCGGGAAGACTGGACAATTAACAATGCTAGCAGTTATCTCGACCTCAGCATTCTTTACGGAAGCTCCGACGACGAAATCAAAACTGTCCGATCTTTTGATGGACGCGGCGGACTA
ATGCCCGACTGTTTTGCGGATGGGAGGCTATTGGGTATGCCTCCTGCCTCGTGTGCGCTTTTAGTCCTTCTTAACCGTAATCACAAT
GTATGAAGCTAAACTCCTTCCCCTGTGTGTCAC
TGCTGACACGTTTGATAGTACATTGCGCAACGAATCTTCGATATCAATGAATGCGGACGATTCCAGGATCCTTCGAGCCTTTCGCCCGAGCTTAAATCAGTTCAAGACGATGAAATATTC
CACAGGACTAGGCTCGTGAATTGCGGGTATTTCATGAATATCATTCTTGGTG
GTACGTTGAATCATTTTGAGATGGCATATTTTTAAGATGGCAACTCTATATAGATTATGTTGGCGCCA
TTCTTGGTCTTGTCCGAGACGGAAATGATTGGCGACTTGACCCTCTCATG
GTTAGTGTTCCGCTGTCTGATCCGGCTTCCCTGTTTAAATAAATCCTCTTTAGAATATGCGAGGCCTCGA
ACACGAAGTCAGCACCCGAGGTGAAGGCAACGTGTGTTCAGTAGAATTTAACTTGCTCTACCGATGGCATACTACTCTTTCCGAGCGAAATGTCGAATGGCTGGAGGATGAATTAGCCAA
GTTTTTGCCACCCGATGCGGACCCTTCAAATGTCGCTGATTTCAAGACCGCCGCCAGGGCCTTCCAGGGCAAGTCTAAAGGGTTACCCCCTTCGAAATGGACTTTTGGAGG
GTATGTAGA
TTCACTTGCTTTTGTGAACTATGCATCCTGAAGTGGATTGTAGGCTATCCCGCGGAACCAGTGGTCGTTTCAAAGACTCGGACCTCGCTAAAGTTATCCAAGAAGCCACACATGACGTTG
CTGGTGCATACAAGGCTCGTGGTATTCCAGCTGCCATGAAGGCGATTGAAGTTATGGGAATCATAAGGTCTCGCCAATGGGGTGTATGTTCT
GTATGTATATTATCTACTCACTGGTTTG
TCCTCGACTGACAGGGGTTTGATCGTAGCTCAACGAGTTCAGGAAATTCATGGGTTTGAAGCGTGAGTTGCCCCGTTGGTTCAATCTAAATTCTTGGCTGATTTTCTGCTAGCATACCAG
AGTTTCAGAGAGTGGAATCCAGATCCAGAGATCTATAATGCTGCAGCTGCGTTGTATAAAAACATCGATAGGCTCGAGCTTCATGTTGGCCTTCAAGCCGAGGAACCAAAATTACCGGGA
CCTGGCGCTGGTTTGTGTCCAGGCTTTACCATTTCTCGGGCCATCCTCTCAGATGCCGTGTGCCTCACTCGTGGAGATCGTTTCCTCACCACAGATTTCACTC
GTAAGTCTGTTTCTTGC
TTACTTTGAATAATCTCTAATAGAGATATTAGCGTTTAACCTTACCGCTTGGGGTTATCAGGATTGTCAATTCGACAAGGAGAATGGTTCATATGGTGGTATGTTGACGAAGCTCCTCTT
CCGGACACTTCCAGATCAGTATCCCGCTGGCTCTGTTCTTGCGCATTTCCCTTTCAACATTCCTACGAAAATGCATGATGTCCTCGCCGCGAGGAACGACGGATCTCTTCAAAGGTACCG
ATGGCCCACGGAGTTGGATCGCACCAATCCACTTCCACCTCTGAAAGATGATTACGAAAGAAAGGTTGTGAATGATTTGGCGGCAGTGAAGCAGGCTTTAATCGTAGATGCCGCCAAGTT
TGTGTCAAATGTCACTGAACGCAAGAAGAAAGTAGTCGGCTCTACTGAG
GTGCGTTTGTATGTTGATGGAGAGGAATTGAAGCTTAAAAAATCTATATCAGGGCCGGCATATTACTCATG
TCAAAGAAGCCATCTTGAATGGGAATAAGTGGGCGGAATACTTCAAGACCAAGACCGAATACCTGTTGAAAAACAAGACGTTGGAAGGAGTGGGATCGAGCGGGCTGTGTTACGTTGATA
TTGTCCAGGATGTGATCAATTTATTGCCTCTCTATTGGATTTGTGAGGAAGTC
GTGAGTGTCTTGTCTTCATCTTTTTGTCTAGCTTCTGAAGCAGTTTATCAGGCTGAGCTCCCTTTGA
AATCGGCTAGTAACCCTTGGGGCGCTTGGTATGAACAGGAGACTTGTGACAAATTCGCCGATATTGCACAATACATCTATTCGACTTTTGAGCCTGTCGACGACTTCAAGCTTCAAACGA
GATCGAAGAAGTACGCGGCGGAGATCATTCAGTTTATCACAGAAACTCTGGATTCACAAGCTAGCACCGTT
GTGAGTAACTAATAGTTCGATTGGGGTAAGAAGAGACTGACGGCTGTGA
AGGGCAGGATATTCGAACAGATGAAAGCTTTGCAGAAAAACGATGATAATAAGGTCTTGAGGTCATTAAAAGATGAAAGCGGCGATGCAGCGCACACGACCGTGGCCAACGATATCTTCG
ATGCGGCCGTCCCTACCGCCGCCTTGTTCTCCAAAGCTATCGTACATGCCGTGGATTACTTCCTTGACGACGCGAACAAGCAGGCCAGGGGTGAAATTGTGAATCTATTCTCCTCTCAGA
GGCCGGATTCCTCGGCTCAAATCATGGGTTATGTTCGGGAAGCACTTCGCTTGAACCCAATC
GTGAGTCGCATTTGGTTTTCGACTTTTGAGCAAAGAATGACATATTTGTAGTTCACTG
GTGTTTATCAAACCTGTCTTCAACCGATCGTTTTGCAGAACCAACGGATTGAAGCGAACGATCAAGTGTTTGTGGATATCTTCAGAGCCAAT
GTAGGACAAATGATTTACGAGTGTGGAT
ATGGCTAAAGAATGCTGTGCAGAGTTCCCTTGGGAGCCGGCCTAATTATTCCCGTCCTGTCCATGATCAGGGTATCTGGTCGCCCTACCAAGAAGGCATGATGACGCCCAAGTTCTTCGA
CACTGTTGTTCCCGCCATCGTTGGAACAATCTTGAGTCAGAAAGGTTTGAAGCGAGCTGATGGTGAATCAGGGAGACTCACAAA
GTAAGATATGCCCATTCGTCCTACTAGTATCTCGTT
GACTGACCCACGCGGTTAGGTTTGATGAGAATTGGCACGGCACTCCACGTCGGCAATATCTGGATATATCTGGTCTTGTAACACCATGGCCAGACACGATGATTGTGCAGTTGCAGGTGA
AAGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCCACTTGACAAATCTACTTCTCAAACTCGCTAGAGACGCTGACTTTAGCGCCGCCTCGCGTGCACCGCTCGATACCGACGGTGCGCACCCCAATACGCACGCCGCGGAAGCGACG
GTCGCTCAGATCATCGACTTCTGTACCAACCCTCCCGTCAGCCTATCTGATTCG
GGCGCATATTGGGATCTTATCAAGAATGGCAACTCGGTTGGCATGGACGACCGAAAAATGCTTTTG
GAGAGACTGTTGGAAGCGATGGCGCGTCTCAGCGATCAGAATCATGGCGCCTCTCTCAAAATACAACAGCTAGTGATCGGTATTC
TTTACAAAGACTTACCACACCCACCTCATGGCTTC
CTTAGCCCATTCGACACTTCAAAGGAACTCTATTTATCCTCCCGCCCTGATGCCAAAACTTCGCCCACAATGCCCAAAGACGTACAGTATGCCTATCGAGCTGCAGATGGCTCTAATTAT
AATCCCTTCATACCTGGCATCGGGAAAGCTGGCTCACCATATGCACGCACTGTTCCTTCCACAAATCTCACCCCAGTCTCCACCCTTCCGGATGCTGGGCTTGTTTTCGATGTGCTTCTG
AAACGAGACAAATTCACCCCTCATCCTGATGGCATTTCTTCTTTCTTCTTCGCAATGGCGGATTTGATTATTCATTGCATATTCAATACCAGTCGGGAAGACTGGACAATTAACAATGCT
AGCAGTTATCTCGACCTCAGCATTCTTTACGGAAGCTCCGACGACGAAATCAAAACTGTCCGATCTTTTGATGGACGCGGCGGACTAATGCCCGACTGTTTTGCGGATGGGAGGCTATTG
GGTATGCCTCCTGCCTCGTGTGCGCTTTTAGTCCTTCTTAACCGTAATCACAAT
TACATTGCGCAACGAATCTTCGATATCAATGAATGCGGACGATTCCAGGATCCTTCGAGCCTTTCG
CCCGAGCTTAAATCAGTTCAAGACGATGAAATATTCCACAGGACTAGGCTCGTGAATTGCGGGTATTTCATGAATATCATTCTTGGTG
ATTATGTTGGCGCCATTCTTGGTCTTGTCCGA
GACGGAAATGATTGGCGACTTGACCCTCTCATG
AATATGCGAGGCCTCGAACACGAAGTCAGCACCCGAGGTGAAGGCAACGTGTGTTCAGTAGAATTTAACTTGCTCTACCGATGGCAT
ACTACTCTTTCCGAGCGAAATGTCGAATGGCTGGAGGATGAATTAGCCAAGTTTTTGCCACCCGATGCGGACCCTTCAAATGTCGCTGATTTCAAGACCGCCGCCAGGGCCTTCCAGGGC
AAGTCTAAAGGGTTACCCCCTTCGAAATGGACTTTTGGAGG
GCTATCCCGCGGAACCAGTGGTCGTTTCAAAGACTCGGACCTCGCTAAAGTTATCCAAGAAGCCACACATGACGTTGCT
GGTGCATACAAGGCTCGTGGTATTCCAGCTGCCATGAAGGCGATTGAAGTTATGGGAATCATAAGGTCTCGCCAATGGGGTGTATGTTCT
CTCAACGAGTTCAGGAAATTCATGGGTTTG
AAGC
CATACCAGAGTTTCAGAGAGTGGAATCCAGATCCAGAGATCTATAATGCTGCAGCTGCGTTGTATAAAAACATCGATAGGCTCGAGCTTCATGTTGGCCTTCAAGCCGAGGAACCA
AAATTACCGGGACCTGGCGCTGGTTTGTGTCCAGGCTTTACCATTTCTCGGGCCATCCTCTCAGATGCCGTGTGCCTCACTCGTGGAGATCGTTTCCTCACCACAGATTTCACTC
CGTTT
AACCTTACCGCTTGGGGTTATCAGGATTGTCAATTCGACAAGGAGAATGGTTCATATGGTGGTATGTTGACGAAGCTCCTCTTCCGGACACTTCCAGATCAGTATCCCGCTGGCTCTGTT
CTTGCGCATTTCCCTTTCAACATTCCTACGAAAATGCATGATGTCCTCGCCGCGAGGAACGACGGATCTCTTCAAAGGTACCGATGGCCCACGGAGTTGGATCGCACCAATCCACTTCCA
CCTCTGAAAGATGATTACGAAAGAAAGGTTGTGAATGATTTGGCGGCAGTGAAGCAGGCTTTAATCGTAGATGCCGCCAAGTTTGTGTCAAATGTCACTGAACGCAAGAAGAAAGTAGTC
GGCTCTACTGAG
GGCCGGCATATTACTCATGTCAAAGAAGCCATCTTGAATGGGAATAAGTGGGCGGAATACTTCAAGACCAAGACCGAATACCTGTTGAAAAACAAGACGTTGGAAGGA
GTGGGATCGAGCGGGCTGTGTTACGTTGATATTGTCCAGGATGTGATCAATTTATTGCCTCTCTATTGGATTTGTGAGGAAGTC
GCTGAGCTCCCTTTGAAATCGGCTAGTAACCCTTGG
GGCGCTTGGTATGAACAGGAGACTTGTGACAAATTCGCCGATATTGCACAATACATCTATTCGACTTTTGAGCCTGTCGACGACTTCAAGCTTCAAACGAGATCGAAGAAGTACGCGGCG
GAGATCATTCAGTTTATCACAGAAACTCTGGATTCACAAGCTAGCACCGTT
GGCAGGATATTCGAACAGATGAAAGCTTTGCAGAAAAACGATGATAATAAGGTCTTGAGGTCATTAAAA
GATGAAAGCGGCGATGCAGCGCACACGACCGTGGCCAACGATATCTTCGATGCGGCCGTCCCTACCGCCGCCTTGTTCTCCAAAGCTATCGTACATGCCGTGGATTACTTCCTTGACGAC
GCGAACAAGCAGGCCAGGGGTGAAATTGTGAATCTATTCTCCTCTCAGAGGCCGGATTCCTCGGCTCAAATCATGGGTTATGTTCGGGAAGCACTTCGCTTGAACCCAATC
TTCACTGGT
GTTTATCAAACCTGTCTTCAACCGATCGTTTTGCAGAACCAACGGATTGAAGCGAACGATCAAGTGTTTGTGGATATCTTCAGAGCCAAT
AGTTCCCTTGGGAGCCGGCCTAATTATTCC
CGTCCTGTCCATGATCAGGGTATCTGGTCGCCCTACCAAGAAGGCATGATGACGCCCAAGTTCTTCGACACTGTTGTTCCCGCCATCGTTGGAACAATCTTGAGTCAGAAAGGTTTGAAG
CGAGCTGATGGTGAATCAGGGAGACTCACAAA
GTTTGATGAGAATTGGCACGGCACTCCACGTCGGCAATATCTGGATATATCTGGTCTTGTAACACCATGGCCAGACACGATGATTGTG
CAGTTGCAGGTGAAAGTGTAA

Retrieve as FASTA