Entry information : AbLDS02_bisporus
Entry ID 7598
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-10 (Catherine Mathe)
Peroxidase information: AbLDS02_bisporus
Name AbLDS02_bisporus
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbLDS02_bisporus
start..stop
S start..stop
AbLDS02_burnettii 2076 0 1..1020 1..1033
LbiLDS02 1200 0 4..1018 5..1018
GluxLDS02 1085 0 14..1018 32..1054
SlutLDS02 1060 0 13..1020 31..1068
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1140399..1140452 54 N° 2 1140242..1140343 102 N° 3 1140137..1140193 57 N° 4 1140001..1140082 82
N° 5 1139838..1139944 107 N° 6 1139699..1139784 86 N° 7 1139630..1139648 19 N° 8 1139512..1139576 65
N° 9 1139283..1139460 178 N° 10 1139046..1139187 142 N° 11 1138911..1138987 77 N° 12 1138787..1138849 63
N° 13 1138484..1138731 248 N° 14 1138387..1138430 44 N° 15 1138238..1138333 96 N° 16 1138035..1138145 111
N° 17 1137567..1137984 418 N° 18 1137283..1137502 220 N° 19 1137136..1137221 86 N° 20 1136969..1137083 115
N° 21 1136633..1136915 283 N° 22 1136452..1136570 119 N° 23 1136284..1136391 108 N° 24 1136043..1136225 183
complement(join(1136043..1136225,1136284..1136391,1136452..1136570,1136633..1136 915,1136969..1137083,1137136..1137221,1137283..1137502,1137567..1137984,1138035. .1138145,1138238..1138333,1138387..1138430,1138484..1138731,1138787..1138849,113 8911..1138987,1139046..1139187,1139283..1139460,1139512..1139576,1139630..113964 8,1139699..1139784,1139838..1139944,1140001..1140082,1140137..1140193,1140242..1 140343,1140399..1140452))


exon

Literature and cross-references AbLDS02_bisporus
DNA ref. JGI genome:   scaffold_6 (1140452..1136043)
Cluster/Prediction ref. JGI gene:   143643
Protein sequence: AbLDS02_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1020
PWM (Da):   %s   114262.89  
PI (pH):   %s   6.61
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKRLSGIFTRQPSTSTGAGNNDDFVPPQTPKSMNNLRAQLKRGTISQPSAVAAVVDAVRHKNAIDDRKLLLEHALALISNMEEGSMATAAKNKIIQLFYSDLTHPASTSLGPKFAWRAPDGARNNPDLPDMGAGTPYSRSVQQTHPLPADQLPDPGLVFDTLLRREFVEHPGGLSAMMFSFAALVIHSVFRTSHRDVYINETSSYVDLSPLYGHNEDVQKKVRAYNGLGYLHPDTFGEDRLRFLPPYIAKKLYEINERGTYKDPANLTPDKRGDQDEEIFQTARLVNCGWFGMIVFSDYFSAILGLVRYGNNWSLLPFEIRQDDHTLYERGKGNVVSVEFNCLYRWHATTSKSDEEWTMQAFRKIFGPDAKPEDFTPEDFKKIAKQAITAKPDPSTWTIGGLERQADGSFRDEDLANVLQNATEDPAARFGARGIASMRLHEIMGLEQSRAWGVCSLNEFRRFLGLKVAKCAEKLYGNIENLELYVGLQAEEAKPLMEGAGLCPGYTISRAILSDAIALTRGDRFFTHDFTPYNLTAWGFADCQRDPGAFGFGSTMGRLLLRTLPDHYSENSVYTFFPFMTPKSMHTNLENIGVLKQYDLDRPSVRPSSVTFSDYKDVAHILESTADFDVVYKEHASRVIKGSGFYPVEDEKARNDVINALSGSPKLVDSIGRYFYETTQKLILENSFTFVGGETFGIDLIKYVVREVPVHWAATDAGIQLKTKENPCGEYTPTELFDILSDIYSFIFIDIEPSKVRVLQYKVEKHIKDLLDLIEIHLGVGNFTINGIIGTVSSFFHKSKRSEEHHEIVKRIDELGYSTDQLANTILAIMVSSVGLSLTLTNIINLYLGSDHDDTLKKLARHDDPQVFTGFVYEGLRLDPAFQGYYRVATKDQTIGKNELKKGDRVFADIGSANLEKMFSEPSKVDPSRSTSACIFGDGPLRFLGETLTVKITSQVLRAIYAYNNVRRAPGASGKLKRFTEGSHPQYHFAYLDRDFKISPWPTSLTIQYDA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (23 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAGAGGCTCTCTGGTATCTTCACTCGTCAACCGAGCACCTCTACTGGTGTAAGTCCAACATATCGTTCCTTGCGCAGTCCTTACTGAGTTATCTCATATCCAGGCTGGTAACAA
CGATGACTTTGTGCCGCCACAAACCCCCAAGTCCATGAACAATTTGCGGGCCCAGTTGAAGCGGGGTACTATTTCACAGCCTAGTGCTGTA
GTAAGTGTGCAGCGCGCTTCAGCCAATTG
TTTCTAACTGATCCTGTAGGCCGCTGTTGTGGACGCAGTTAGGCATAAAAATGCTATTGATGACAGGAAACTCTTGGTTAGTGTTGATTCTGTGTGGGCGTGAAGTCGACATTGAATTGT
GTATCGTCAGCTCGAGCATGCTCTCGCTCTCATATCTAATATGGAAGAGGGTTCTATGGCAACTGCGGCGAAGAACAAAATCATTCAGCTCTGTAGGTCTTTGTCCTGCGCCCTAGAATC
AACTATGTTTACACCGGGGCCGTATTAGTTTACAGTGATTTGACACATCCCGCTTCCACTAGCCTGGGACCAAAGTTTGCTTGGCGTGCTCCTGATGGAGCTAGGAACAATCCCGACTTG
CCGGACATGGGCAGG
GTATAGCTTCATTCGTTGGGCGCATGTCTTTGCCGCTGACAAGTTCATGATAGGCTGGTACACCCTATTCCCGCTCCGTTCAACAAACCCATCCTTTACCGGCCG
ATCAATTGCCGGATCCTGGTCTTGTGTTTGATAC
GTAAGTAGACATAGTGTTTTCCTTGCATTTTTGTATTGATGTTTCGTAAGGTTACTGCGTCGTGAATCGGTGGGTGTGGTACTGAT
ACGCTTTCCAATGTTGATCTGACTGAGGTATTTCAGTTTGTCGAGCACCCGGGCGGGCTCTCTGCCATGATGTTCTCGTTTGCTGCTCTTGTCATTCACAGGTACATCACTCACTTTTCA
CATTTCTCACGCTTTTGTTGATCATCATCTAGCGTCTTCCGTACATCGCATAGGGATGTCTACATCAACGAAACTTCTTCCTACGTGGACTTGTCTCCCTTGTATGGACACAATGAAGAC
GTACAGAAGAAAGTTCGCGCATACAATGGGCTAGGATATTTGCATCCCGATACTTTCGGTGAAGATCGTCTCCGCTTTCTTCCTCCTGCG
GTTTGTAGTATCCTCATTCTCTTCAACCGC
AACCACAATGTTCGTCCTTTTTCTTTCTCTCTCTCTTGCATGACACTCATCACGTTGTGTAATAGTACATTGCGAAGAAACTTTATGAAATCAACGAAAGGGGTACCTATAAAGATCCCG
CTAATCTGACCCCCGATAAACGCGGTGACCAAGATGAAGAGATTTTCCAAACAGCTAGACTGGTCAATTGCGGCTGGTTTGGAATGA
GTACTTCGCTCCTTTCTACCTCAAATTCGGGAA
ATTACTGATTCATCTTGTCTTACAGTTGTTTTCTCAGATTATTTCTCTGCTATATTGGGTCTTGTCCGTTATGGAAATAACTGGAGTCTGTTACCATTTGACGTGAGTGGTATTTTATGT
ATCCTCTCTTTACTGAGAAGGTTACTGATTCTGCATAAAATAGGAAATTCGCCAGGATGACCACACCCTCTATGAGCGTGGTAAGGGCAATGTTGTCAGTGTTGAGGTTAGTGAAAGTAT
CACTTGGTATTAGAATTCTTGCTAATGATCAATGGCCTTAGTTCAACTGCCTTTATCGTTGGCACGCCACTACCAGCAAATCAGACGAGGAGTGGACGATGCAAGCCTTCCGCAAAATTT
TTGGCCCCGACGCTAAACCGGAAGATTTTACTCCTGAGGACTTTAAGAAGATTGCCAAGCAAGCGATTACCGCAAAACCCGATCCTTCAACTTGGACTATTGGAGGGCTCGAACGCCAAG
CTGATGGATCCTTCCGTGATGAAGACCTTGCCAATGTCCTTCAGAATGC
GTAAGTAAAATCAAACCAGAAATTGACCTTGAAAATCGAAAATTTGTTTCCAGTACGGAGGACCCTGCAGC
TCGCTTTGGAGCTCGTGGTATTCCAG
GTGGGTTGATGGTTTGTCCTATCGATGGGACGTCCGGCTGACCGTTACTGTAGCTAGTATGCGCTTGCATGAAATCATGGGTCTTGAGCAGAGT
CGCGCTTGGGGTGTTTGCTCTCTGAATGAATTCAGGAGATTCTTGGGGCTCAAAG
GTAAGGCTTTCATACAAACTGCTGAGCTTGGGCCGAAGTTAAATGCGACACAGCCTTTGAAAACT
TCTCCGAATGGAATTCTGATCCTGCAGTTGCAAAGTGTGCTGAAAAGCTTTATGGCAACATTGAAAATTTGGAACTCTATGTTGGCCTCCAAGCTGAAGAGGCTAAACCACTTATGGAAG
GAGCTGGATTGTGTCCAG
GTAAGTAGCTAGAGAGACTTGATTTAGCTGTTTTACTAATGACAACTCAGGATACACCATTAGTCGTGCCATCCTGAGTGACGCTATTGCGCTCACTCGCGG
AGATCGCTTCTTCACCCACGATTTCACTCCTTATAACCTCACCGCTTGGGGTTTCGCTGACTGTCAACGTGATCCCGGAGCTTTTGGTTTTGGGAGCACAATGGGCAGGCTCTTGCTTCG
CACACTTCCCGACCACTACTCGGAGAACAGTGTCTATACGTTCTTCCCGTTCATGACACCCAAGTCAATGCATACTAATCTCGAAAACATTGGCGTCCTCAAGCAGTACGACCTCGATAG
GCCCTCTGTCAGACCATCTTCCGTCACTTTCAGTGATTATAAAGATGTGGCCCATATCCTCGAATCCACCGCAGACTTTGATGTCGTCTACAAGGAGCATGCTTCACGCGTCATTAAAGG
CAGCGG
GTATGTGCTTTGTTTGCTATGAAGTGATGAGGTGATCTGTGATACTTACTTGTGAATTGGGTAGATTCTATCCGGTTGAGGATGAAAAGGCAAGGAATGATGTCATCAATGCTC
TAAGTGGTTCGCCGAAGTTGGTGGACAGTATCGGTCGCTACTTCTATGAAACGACTCAGAAACTCATCCTCGAGAACTCGTTTACTTTCGTTGGTGGTGAAACATTCGGTATTGACTTGA
TCAAATATGTTGTCCGTGAAGTTCCTGTTCATTGGGCCGCAACGGACGTG
GTGCGTGAAGCTTTTTGTCTCTAGAGTTTTTGATGTCTAATACTTATATTCTCAAACTTAGGCTGGAATT
CAACTCAAGACAAAGGAGAACCCCTGTGGTGAATATACTCCTACAGAGTTATTCGATATCTTGAGTGATATCTACTC
GTAAGAGTTTACTTTTTGTGTTGTATGCAATGGTTATAACTGT
GGTCCTTAGATTTATCTTCATTGATATTGAGCCTTCGAAGGTCCGGGTACTACAGTACAAAGTAGAGAAACATATCAAGGACTTGCTCGACCTTATTGAGATTCACCTTGGCGTTGGCAA
CAGG
GTATGTCCAGATGCCGGATATTACCTTAACCTCTTTGTCTAATTATAGACTAGTTCACTATAAACGGTATCATCGGCACTGTTTCCTCCTTCTTCCACAAGTCCAAACGAAGCGAG
GAGCATCATGAAATCGTCAAAAGGATTGACGAGCTCGGTTATTCTACCGATCAACTCGCGAACACTATCTTGGCCATCATGGTTTCTTCCGTTGGCCTTTCTTTGACTTTGACCAATATC
ATCAATCTCTACCTTGGAAGCGACCACGATGATACTTTGAAGAAACTTGCTCGTCATGATGATCCTCAAGTATTTACTGGATTTGTATACGAAGGTCTAC
GTAAGTTTCATTGCGCGCCA
CTTTACTTTTCCTGGTGTCTAATATCTGTTTTTTAAATGAAGGCCTCGACCCTGCCTTCCAAGGCTACTATCGTGTGGCCACAAAGGACCAAACGATTGGTAAAAATGAATTAAAGAAGG
GTGATCGTGTCTTTGCCGACATTGGTTCTGCTAACCTCAAT
GTATGTGATCAAGAATCATTGAACCTCCTGATGCATCAAGCCTAACCTTACTTACAATAGGAAAAGATGTTCTCCGAGC
CCTCCAAAGTGGACCCCTCACGTTCAACGTCTGCTTGTATCTTCGGCGACGGACCTTTGAGATTCCTTGGTGAAACTCTGACTGTCAAA
GTTAGTTAACGATTTTCGAGGTCAAAACAGG
TACTGACGATAGAAAACTTTGCACTAGATTACTTCCCAAGTTCTCCGCGCTATCTATGCTTACAACAATGTTAGGCGTGCTCCTGGCGCTTCTGGTAAACTCAAGAGGTTTACTGAGGGC
AGCCATCCTCAATACCACTTCGCTTATCTCGACCGTGATTTCAAGATTTCGCCCTGGCCGACGTCTCTTACCATTCAGTATGATGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAGAGGCTCTCTGGTATCTTCACTCGTCAACCGAGCACCTCTACTGGTGCTGGTAACAACGATGACTTTGTGCCGCCACAAACCCCCAAGTCCATGAACAATTTGCGGGCCCAG
TTGAAGCGGGGTACTATTTCACAGCCTAGTGCTGTA
GCCGCTGTTGTGGACGCAGTTAGGCATAAAAATGCTATTGATGACAGGAAACTCTTGCTCGAGCATGCTCTCGCTCTCATATCT
AATATGGAAGAGGGTTCTATGGCAACTGCGGCGAAGAACAAAATCATTCAGCTCT
TTTACAGTGATTTGACACATCCCGCTTCCACTAGCCTGGGACCAAAGTTTGCTTGGCGTGCTCCT
GATGGAGCTAGGAACAATCCCGACTTGCCGGACATGGGCAGG
GCTGGTACACCCTATTCCCGCTCCGTTCAACAAACCCATCCTTTACCGGCCGATCAATTGCCGGATCCTGGTCTTGTG
TTTGATAC
GTTACTGCGTCGTGAATCGTTTGTCGAGCACCCGGGCGGGCTCTCTGCCATGATGTTCTCGTTTGCTGCTCTTGTCATTCACAGCGTCTTCCGTACATCGCATAGGGATGTC
TACATCAACGAAACTTCTTCCTACGTGGACTTGTCTCCCTTGTATGGACACAATGAAGACGTACAGAAGAAAGTTCGCGCATACAATGGGCTAGGATATTTGCATCCCGATACTTTCGGT
GAAGATCGTCTCCGCTTTCTTCCTCCTGCG
TACATTGCGAAGAAACTTTATGAAATCAACGAAAGGGGTACCTATAAAGATCCCGCTAATCTGACCCCCGATAAACGCGGTGACCAAGAT
GAAGAGATTTTCCAAACAGCTAGACTGGTCAATTGCGGCTGGTTTGGAATGA
TTGTTTTCTCAGATTATTTCTCTGCTATATTGGGTCTTGTCCGTTATGGAAATAACTGGAGTCTGTTA
CCATTTGAC
GAAATTCGCCAGGATGACCACACCCTCTATGAGCGTGGTAAGGGCAATGTTGTCAGTGTTGAGTTCAACTGCCTTTATCGTTGGCACGCCACTACCAGCAAATCAGACGAG
GAGTGGACGATGCAAGCCTTCCGCAAAATTTTTGGCCCCGACGCTAAACCGGAAGATTTTACTCCTGAGGACTTTAAGAAGATTGCCAAGCAAGCGATTACCGCAAAACCCGATCCTTCA
ACTTGGACTATTGGAGGGCTCGAACGCCAAGCTGATGGATCCTTCCGTGATGAAGACCTTGCCAATGTCCTTCAGAATGC
TACGGAGGACCCTGCAGCTCGCTTTGGAGCTCGTGGTATT
CCAG
CTAGTATGCGCTTGCATGAAATCATGGGTCTTGAGCAGAGTCGCGCTTGGGGTGTTTGCTCTCTGAATGAATTCAGGAGATTCTTGGGGCTCAAAGTTGCAAAGTGTGCTGAAAAG
CTTTATGGCAACATTGAAAATTTGGAACTCTATGTTGGCCTCCAAGCTGAAGAGGCTAAACCACTTATGGAAGGAGCTGGATTGTGTCCAG
GATACACCATTAGTCGTGCCATCCTGAGT
GACGCTATTGCGCTCACTCGCGGAGATCGCTTCTTCACCCACGATTTCACTCCTTATAACCTCACCGCTTGGGGTTTCGCTGACTGTCAACGTGATCCCGGAGCTTTTGGTTTTGGGAGC
ACAATGGGCAGGCTCTTGCTTCGCACACTTCCCGACCACTACTCGGAGAACAGTGTCTATACGTTCTTCCCGTTCATGACACCCAAGTCAATGCATACTAATCTCGAAAACATTGGCGTC
CTCAAGCAGTACGACCTCGATAGGCCCTCTGTCAGACCATCTTCCGTCACTTTCAGTGATTATAAAGATGTGGCCCATATCCTCGAATCCACCGCAGACTTTGATGTCGTCTACAAGGAG
CATGCTTCACGCGTCATTAAAGGCAGCGG
ATTCTATCCGGTTGAGGATGAAAAGGCAAGGAATGATGTCATCAATGCTCTAAGTGGTTCGCCGAAGTTGGTGGACAGTATCGGTCGCTAC
TTCTATGAAACGACTCAGAAACTCATCCTCGAGAACTCGTTTACTTTCGTTGGTGGTGAAACATTCGGTATTGACTTGATCAAATATGTTGTCCGTGAAGTTCCTGTTCATTGGGCCGCA
ACGGACGTG
GCTGGAATTCAACTCAAGACAAAGGAGAACCCCTGTGGTGAATATACTCCTACAGAGTTATTCGATATCTTGAGTGATATCTACTCATTTATCTTCATTGATATTGAGCCT
TCGAAGGTCCGGGTACTACAGTACAAAGTAGAGAAACATATCAAGGACTTGCTCGACCTTATTGAGATTCACCTTGGCGTTGGCAACAGG
TTCACTATAAACGGTATCATCGGCACTGTT
TCCTCCTTCTTCCACAAGTCCAAACGAAGCGAGGAGCATCATGAAATCGTCAAAAGGATTGACGAGCTCGGTTATTCTACCGATCAACTCGCGAACACTATCTTGGCCATCATGGTTTCT
TCCGTTGGCCTTTCTTTGACTTTGACCAATATCATCAATCTCTACCTTGGAAGCGACCACGATGATACTTTGAAGAAACTTGCTCGTCATGATGATCCTCAAGTATTTACTGGATTTGTA
TACGAAGGTCTAC
GCCTCGACCCTGCCTTCCAAGGCTACTATCGTGTGGCCACAAAGGACCAAACGATTGGTAAAAATGAATTAAAGAAGGGTGATCGTGTCTTTGCCGACATTGGTTCT
GCTAACCTCAAT
GAAAAGATGTTCTCCGAGCCCTCCAAAGTGGACCCCTCACGTTCAACGTCTGCTTGTATCTTCGGCGACGGACCTTTGAGATTCCTTGGTGAAACTCTGACTGTCAAA
ATTACTTCCCAAGTTCTCCGCGCTATCTATGCTTACAACAATGTTAGGCGTGCTCCTGGCGCTTCTGGTAAACTCAAGAGGTTTACTGAGGGCAGCCATCCTCAATACCACTTCGCTTAT
CTCGACCGTGATTTCAAGATTTCGCCCTGGCCGACGTCTCTTACCATTCAGTATGATGCTTGA

Retrieve as FASTA