Entry information : AbNOx01_bisporus
Entry ID 7599
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbNOx01_bisporus
Name AbNOx01_bisporus
Class Ancestral NADPH oxidase    [Orthogroup: NOx002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbNOx01_bisporus
start..stop
S start..stop
LbiNOx01 972 0 1..557 1..559
CcinNOx01 948 0 1..557 1..558
PcNOx01 936 0 1..557 1..559
PcarNOx01 932 0 1..557 1..559
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2427639..2427749 111 N° 2 2427806..2428076 271 N° 3 2428132..2428521 390 N° 4 2428584..2428684 101
N° 5 2428740..2429040 301 N° 6 2429101..2429265 165 N° 7 2429319..2429548 230 N° 8 2429612..2429716 105
join(2427639..2427749,2427806..2428076,2428132..2428521,2428584..2428684,2428740 ..2429040,2429101..2429265,2429319..2429548,2429612..2429716)


exon

Literature and cross-references AbNOx01_bisporus
DNA ref. JGI genome:   scaffold_1 (2427639..2429716)
Cluster/Prediction ref. JGI gene:   189922
Protein sequence: AbNOx01_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   557
PWM (Da):   %s   63971.62 Transmb domain:   %s   i16-38o53-75i102-124o139-161i174-196o216-238i378-400o
PI (pH):   %s   9.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSESWFHREFLTPRRLAFNVFFYGTHLAIFAYGWYSQQVNTKLAGLNSLKWSVWSSRGAGLVLAYDGGLIFLPMLRNIIRVIRPHLTWLFPADENIWFHRQVAYSMAFWAMVHTTAHYVNFINVERTQIRPLYALQIHYTQAGGITGHFMLLIMVIMYTLAHQKVRKQCFEAFWYSHHLAFFFVIGLYSHATGCFVRDTPDPTYIPSFPFYNVEHCLGYFSWRFIIWPFLIYFGERVWREIRARKPTRLSKVLVHPSGAMELRIIKPSFKYTPGQWLFVQIPELSKFQWHFTITSAPEDPYVSIHIRQVGDWTESLGERLGVGPAMVSSMTKDAMMGKEKGFDQGQGDFVELDTTYSAISLPALRIDGPYGAPTEDVFNAEVAILIGAGIGVTPFASILKHMWYRQKRNTLKSLRRVEFFWICRDSPSFGWFQSLLKEVEAAQADPNFLRINIYLTQKIGEDMLWNIAVNDTGAEYDPLTLLRTRTMFGRPDWNSIYSRMKGAIQNGSYLPGSTSQLSTKVTYFCGPPAIAKALKEATVKHSDSSVNFTFAKEHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGAATCTTGGTTCCACCGCGAATTTTTGACTCCTCGAAGGCTTGCCTTCAACGTTTTCTTTTATGGCACTCATCTCGCTATCTTCGCCTACGGTTGGTACAGTCAGGTGAGCATT
TTCTATTCACCTTCAAACCTCGCCTCCTTCCTTATTTCGATCTACAGCAAGTAAACACAAAGCTAGCCGGTCTCAACTCTCTCAAATGGTCGGTGTGGTCTTCTCGTGGAGCTGGCCTCG
TTCTTGCCTACGACGGTGGTTTGATATTCCTCCCCATGCTTCGTAACATCATTCGTGTCATTCGCCCTCACCTCACATGGCTCTTCCCCGCCGATGAAAACATATGGTTCCATCGTCAGG
TTGCTTACTCTATGGCATTTTGGGCTATGGTGCACACCACCGCTCACTACGTTAATTTCATCAATGTCGAGAGGACTC
GTGCGTTGCAATTCTCTTTAAAGTCCTTTTTATTCTCACAAT
TCTTTGCGTTTAGAAATTCGTCCGTTGTACGCATTGCAAATCCACTACACCCAGGCGGGTGGCATCACAGGGCACTTCATGCTTCTGATAATGGTGATCATGTATACTCTCGCGCATCAA
AAAGTTCGCAAGCAATGCTTTGAAGCATTTTGGTACTCCCATCATTTAGCTTTCTTCTTCGTGATCGGTCTCTACTCCCATGCCACCGGATGCTTTGTCCGCGACACTCCCGACCCAACG
TACATACCTTCCTTCCCGTTCTATAATGTAGAACACTGTCTCGGATACTTCAGTTGGAGGTTTATCATCTGGCCGTTCCTCATTTACTTTGGCGAACGTGTGTGGAGAGAGATTCGTGCT
CGTAAACCAACTCGTCTTTCTAAGGTCCTCGTCCATCCTAGTG
GTACGTCGTTGTTAAAAGCATACCATGCGGCACCTTGACGCCAGTTTCTTTTTCACAATCAGGCGCGATGGAACTCC
GCATTATAAAGCCTAGCTTCAAGTATACGCCCGGCCAGTGGCTTTTCGTCCAAATTCCAGAGCTTTCCAAATTCCAGTGGCACCCT
GTAGGTGTTCTACTTCGTCGACATGCTCCTATCC
TGATCCCTCCTGTTGTATTAGTTCACGATCACGTCAGCCCCTGAGGACCCCTACGTATCCATTCACATCCGTCAAGTTGGTGATTGGACTGAGTCTCTCGGAGAGCGACTCGGCGTTGGT
CCTGCCATGGTCAGTTCCATGACCAAGGATGCAATGATGGGTAAAGAGAAAGGTTTCGACCAAGGTCAAGGTGACTTCGTAGAATTGGATACTACCTATTCTGCCATCTCGCTTCCAGCT
CTGAGGATTGATGGACCTTATGGTGCACCTACGGAAGACGTCTTCAATGCTGAGGTTGCTATCCTTATTGGTGCTGGCATTG
GTCGGTCTGATTCTTTCCTTGAAATGGATTGGAATTAA
TCTTGGTCCATCTATTGAATAGGTGTCACGCCTTTTGCATCCATCTTGAAACATATGTGGTACCGTCAGAAGCGCAACACTCTCAAGAGTCTGCGTCGCGTCGAATTCTTCTGGATTTGC
CGTGACTCGCCTTCCTTCGGTTGGTTCCAGAGCTTGTTGAAGGAAGTTGAAGCTGCACAAGCTGATC
GTGAGTCAAAATTACACCTTGGCTACTACAGTCGTAACCATCTTTATGTTTAG

CCAATTTCCTCCGAATTAACATCTACCTGACCCAAAAGATTGGAGAAGATATGCTTTGGAATATCGCTGTCAATGACACTGGAGCGGAATACGACCCCCTGACCCTCCTCCGTACTCGTA
CCATGTTCGGAAGGCCTGATTGGAATTCCATCTACTCACGGATGAAGGGGGCCATCCAAAATGGTAGCTACCTTCCCGGAAGCACGTCGCAGCTCAGCACCAAAGTCGCT
GTACGTCACA
TTTATTTTATGAATTATATTATATGTACGATTGTCTAAATGATATTCTAACAGACTTATTTCTGTGGTCCTCCTGCAATCGCTAAAGCCCTTAAAGAAGCTACCGTCAAGCATTCTGACT
CTAGTGTCAACTTCACCTTTGCTAAAGAGCACTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGAATCTTGGTTCCACCGCGAATTTTTGACTCCTCGAAGGCTTGCCTTCAACGTTTTCTTTTATGGCACTCATCTCGCTATCTTCGCCTACGGTTGGTACAGTCAGCAAGTAAAC
ACAAAGCTAGCCGGTCTCAACTCTCTCAAATGGTCGGTGTGGTCTTCTCGTGGAGCTGGCCTCGTTCTTGCCTACGACGGTGGTTTGATATTCCTCCCCATGCTTCGTAACATCATTCGT
GTCATTCGCCCTCACCTCACATGGCTCTTCCCCGCCGATGAAAACATATGGTTCCATCGTCAGGTTGCTTACTCTATGGCATTTTGGGCTATGGTGCACACCACCGCTCACTACGTTAAT
TTCATCAATGTCGAGAGGACTC
AAATTCGTCCGTTGTACGCATTGCAAATCCACTACACCCAGGCGGGTGGCATCACAGGGCACTTCATGCTTCTGATAATGGTGATCATGTATACTCTC
GCGCATCAAAAAGTTCGCAAGCAATGCTTTGAAGCATTTTGGTACTCCCATCATTTAGCTTTCTTCTTCGTGATCGGTCTCTACTCCCATGCCACCGGATGCTTTGTCCGCGACACTCCC
GACCCAACGTACATACCTTCCTTCCCGTTCTATAATGTAGAACACTGTCTCGGATACTTCAGTTGGAGGTTTATCATCTGGCCGTTCCTCATTTACTTTGGCGAACGTGTGTGGAGAGAG
ATTCGTGCTCGTAAACCAACTCGTCTTTCTAAGGTCCTCGTCCATCCTAGTG
GCGCGATGGAACTCCGCATTATAAAGCCTAGCTTCAAGTATACGCCCGGCCAGTGGCTTTTCGTCCAA
ATTCCAGAGCTTTCCAAATTCCAGTGGCACCCT
TTCACGATCACGTCAGCCCCTGAGGACCCCTACGTATCCATTCACATCCGTCAAGTTGGTGATTGGACTGAGTCTCTCGGAGAGCGA
CTCGGCGTTGGTCCTGCCATGGTCAGTTCCATGACCAAGGATGCAATGATGGGTAAAGAGAAAGGTTTCGACCAAGGTCAAGGTGACTTCGTAGAATTGGATACTACCTATTCTGCCATC
TCGCTTCCAGCTCTGAGGATTGATGGACCTTATGGTGCACCTACGGAAGACGTCTTCAATGCTGAGGTTGCTATCCTTATTGGTGCTGGCATTG
GTGTCACGCCTTTTGCATCCATCTTG
AAACATATGTGGTACCGTCAGAAGCGCAACACTCTCAAGAGTCTGCGTCGCGTCGAATTCTTCTGGATTTGCCGTGACTCGCCTTCCTTCGGTTGGTTCCAGAGCTTGTTGAAGGAAGTT
GAAGCTGCACAAGCTGATC
CCAATTTCCTCCGAATTAACATCTACCTGACCCAAAAGATTGGAGAAGATATGCTTTGGAATATCGCTGTCAATGACACTGGAGCGGAATACGACCCCCTG
ACCCTCCTCCGTACTCGTACCATGTTCGGAAGGCCTGATTGGAATTCCATCTACTCACGGATGAAGGGGGCCATCCAAAATGGTAGCTACCTTCCCGGAAGCACGTCGCAGCTCAGCACC
AAAGTCGCT
ACTTATTTCTGTGGTCCTCCTGCAATCGCTAAAGCCCTTAAAGAAGCTACCGTCAAGCATTCTGACTCTAGTGTCAACTTCACCTTTGCTAAAGAGCACTTTTAA

Retrieve as FASTA