Entry information : AbNOx02_bisporus
Entry ID 7600
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbNOx02_bisporus
Name AbNOx02_bisporus
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbNOx02_bisporus
start..stop
S start..stop
LbiNOx02 1004 0 1..609 1..604
PcNOx02 976 0 2..609 6..609
PcarNOx02 948 0 2..609 5..611
CcinNOx02 941 0 6..609 5..608
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 932286..932664 379 N° 2 931734..932230 497 N° 3 931461..931681 221 N° 4 931127..931405 279
N° 5 930999..931065 67 N° 6 930664..930945 282 N° 7 930510..930603 94 N° 8 930436..930446 11
complement(join(930436..930446,930510..930603,930664..930945,930999..931065,9311 27..931405,931461..931681,931734..932230,932286..932664))


exon

Literature and cross-references AbNOx02_bisporus
DNA ref. JGI genome:   scaffold_10 (932664..930436)
Protein sequence: AbNOx02_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   609
PWM (Da):   %s   68973.56 Transmb domain:   %s   i89-111o126-148i169-191o218-240i253-275o285-304i444-466o
PI (pH):   %s   9.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSKHSSGLDFSDGPSPMLQLQQHPDLAIPYGSGTQPGHLQRNKTERRRLQGLQRSNTVGSLAQPALNKAMTCKQRFDIWMINEGGRQLFFGVWIILHLLVAIFGFFNYQLKDNNVDARATFGITYAISRTAALLLHLDVIYILLPVCRNFISLLRRTPLNDFIPFDKAVTLHKATGWSIVIFSVVHIIAHMVNFAKLAIAQPPEAGNKVVIFLLTNFTTGPGVTGWIMTACLGIMAFFAMEKRRRAHFERFWYSHHLFIIFFINWQFHGMFCMIKPDRPPYCSYNNIGVFKYWLIGGVIWIVERVLREVRSRHYTYISKVIQHPSNVMELQIKKEKTATRAGQYIFICCPEVSYFQWHPFTLTSAPEEDYLSVHISVKGDFTTALAKSCGCDFSKKKGDKDSAAGGKVIGTNYNPPMNVTLPRVMVDGPFGSASEDFSKYETVLLVGAGIGVTPFASILKTIWYRMNGLNKSKPTRLSVYFTLVIRDFGAAEWFHSLLHAIEEQDIGNRIEINIYLTAKLKEDEMNNIIVQDVGAEKDAITSLRAPTHFGRPKWDRVFGSITEKHPETDVGVFYCGPPALSKTLHQMSNKWSNPKGTRFFFGKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCCAAACACTCGTCGGGTTTGGATTTTTCCGATGGGCCGAGCCCAATGCTACAGCTCCAACAGCACCCCGATCTCGCCATTCCGTATGGCTCTGGTACTCAGCCCGGTCATCTC
CAACGGAATAAGACGGAGAGAAGGAGGTTGCAAGGCCTTCAACGCTCCAACACCGTTGGTTCACTCGCTCAGCCGGCTCTCAATAAGGCTATGACTTGCAAGCAACGGTTTGATATATGG
ATGATTAATGAAGGAGGGCGTCAGTTATTCTTTGGTGTTTGGATTATTTTGCACCTTTTGGTCGCTATCTTCGGTTTTTTCAACTACCAGCTCAAGGACAACAATGTCGATGCTCGGGCT
ACTTTTGGAATTACTTACG
GTTCGTGCGCTGTTTTGGAATGTAATTTATTCGCTCACGCTGTGCTCTTTCCCAGCTATCAGTCGTACAGCTGCATTGCTTCTTCATCTCGATGTCATCTA
CATCCTCCTGCCCGTCTGCCGCAACTTCATCTCTCTACTACGTCGCACGCCACTGAACGATTTTATCCCCTTCGACAAGGCCGTCACCCTTCACAAGGCGACCGGTTGGTCCATCGTGAT
TTTTTCTGTCGTTCACATTATTGCCCACATGGTCAACTTTGCAAAACTTGCAATAGCGCAGCCCCCCGAAGCCGGCAATAAAGTCGTCATTTTCCTTCTTACCAATTTCACCACTGGTCC
TGGTGTTACTGGGTGGATCATGACAGCCTGTCTGGGTATCATGGCTTTCTTCGCCATGGAGAAACGCCGTCGCGCTCATTTCGAGCGATTTTGGTACTCTCACCACCTTTTCATTATCTT
CTTCATCAACTGGCAATTCCATGGCATGTTTTGCATGATCAAACCCGATCGTCCACCTTACTGCTCATACAACAATATTGGGGTGTTCTGG
GTGAGTATTATTTGACGCGTTGAGTGATT
TTGACCATTCTAATGACTTACAGAAATACTGGCTTATCGGTGGTGTCATCTGGATTGTTGAACGAGTCCTCCGCGAGGTCCGCTCCCGCCACTATACCTATATCTCCAAAGTTATTCAAC
ACCCGTCAAATGTCATGGAGCTCCAGATCAAGAAGGAGAAGACTGCAACTCGCGCCGGACAGTACATCTTTATCTGCTGCCCTGAGGTCTCGTACTTCCAATGGCACCCCTTCACCCTAA
CCAG
GTACATATCTGTCCCAATCTTGACACTCCGCTCTGACTGACTGTGATGTACGTAGTGCTCCCGAGGAAGATTACTTGTCGGTCCACATCTCTGTCAAGGGTGACTTTACTACGGCG
CTTGCGAAATCTTGTGGCTGCGACTTCTCTAAGAAAAAAGGAGATAAAGATTCAGCTGCTGGAGGCAAAGTTATTGGTACCAACTATAATCCTCCCATGAACGTGACACTTCCCCGTGTG
ATGGTCGATGGTCCCTTCGGAAGTGCTAGTGAGGATTTCTCGAAGTATGAGACGGTTTTATTGGTCGGAGCTGGTATTGGTGTTACGCCCTTTGCATC
GTGAGTCTCATCTTTTCCTTCT
GCGAAAGAGGTCCCGTATTGACCTACTGTTTGATTTAAGTATTTTGAAGACTATTTGGTACCGTATGAATGGCCTTAACAAATCCAAACCCACTCGACTTTCCAAGGTAATCGCTTCCGC
TACCATTTTTGTCACCAATAATACTTAGTTGTATTTCAGGTCTACTTCACCCTGGTCATTCGTGATTTTGGCGCTGCGGAATGGTTCCACTCACTCCTCCACGCTATCGAAGAACAAGAC
ATCGGAAATCGTATTGAAATTAACATATACCTCACTGCGAAGTTGAAAGAAGATGAAATGAACAACATCATTGTTCAAGATGTTGGGGCTGAAAAGGATGCCATCACTTCGCTTCGCGCT
CCTACTCACTTTGGTCGTCCTAAATGGGACCGCGTGTTTGGTTCAATTACTGAGAAACACCCTGAAACTGATGTTGGCGTG
GTATGTGCTTTTTTTTTTTTCAACTATAAACAAGTCTCA
TAGTGAACTTTTCATGAATAGTTTTATTGTGGCCCTCCTGCTTTGTCCAAGACTCTACACCAAATGTCGAACAAATGGTCCAATCCAAAGGGCACCCGGTTCTTCTTCGGCAAAGGTACG
TCTCAATCCAGTATGAACTCATTAGCAATGGAATAAACCTCGCATTTTTTTTTCATAGAGAACTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCCAAACACTCGTCGGGTTTGGATTTTTCCGATGGGCCGAGCCCAATGCTACAGCTCCAACAGCACCCCGATCTCGCCATTCCGTATGGCTCTGGTACTCAGCCCGGTCATCTC
CAACGGAATAAGACGGAGAGAAGGAGGTTGCAAGGCCTTCAACGCTCCAACACCGTTGGTTCACTCGCTCAGCCGGCTCTCAATAAGGCTATGACTTGCAAGCAACGGTTTGATATATGG
ATGATTAATGAAGGAGGGCGTCAGTTATTCTTTGGTGTTTGGATTATTTTGCACCTTTTGGTCGCTATCTTCGGTTTTTTCAACTACCAGCTCAAGGACAACAATGTCGATGCTCGGGCT
ACTTTTGGAATTACTTACG
CTATCAGTCGTACAGCTGCATTGCTTCTTCATCTCGATGTCATCTACATCCTCCTGCCCGTCTGCCGCAACTTCATCTCTCTACTACGTCGCACGCCACTG
AACGATTTTATCCCCTTCGACAAGGCCGTCACCCTTCACAAGGCGACCGGTTGGTCCATCGTGATTTTTTCTGTCGTTCACATTATTGCCCACATGGTCAACTTTGCAAAACTTGCAATA
GCGCAGCCCCCCGAAGCCGGCAATAAAGTCGTCATTTTCCTTCTTACCAATTTCACCACTGGTCCTGGTGTTACTGGGTGGATCATGACAGCCTGTCTGGGTATCATGGCTTTCTTCGCC
ATGGAGAAACGCCGTCGCGCTCATTTCGAGCGATTTTGGTACTCTCACCACCTTTTCATTATCTTCTTCATCAACTGGCAATTCCATGGCATGTTTTGCATGATCAAACCCGATCGTCCA
CCTTACTGCTCATACAACAATATTGGGGTGTTCTGG
AAATACTGGCTTATCGGTGGTGTCATCTGGATTGTTGAACGAGTCCTCCGCGAGGTCCGCTCCCGCCACTATACCTATATCTCC
AAAGTTATTCAACACCCGTCAAATGTCATGGAGCTCCAGATCAAGAAGGAGAAGACTGCAACTCGCGCCGGACAGTACATCTTTATCTGCTGCCCTGAGGTCTCGTACTTCCAATGGCAC
CCCTTCACCCTAACCAG
TGCTCCCGAGGAAGATTACTTGTCGGTCCACATCTCTGTCAAGGGTGACTTTACTACGGCGCTTGCGAAATCTTGTGGCTGCGACTTCTCTAAGAAAAAAGGA
GATAAAGATTCAGCTGCTGGAGGCAAAGTTATTGGTACCAACTATAATCCTCCCATGAACGTGACACTTCCCCGTGTGATGGTCGATGGTCCCTTCGGAAGTGCTAGTGAGGATTTCTCG
AAGTATGAGACGGTTTTATTGGTCGGAGCTGGTATTGGTGTTACGCCCTTTGCATC
TATTTTGAAGACTATTTGGTACCGTATGAATGGCCTTAACAAATCCAAACCCACTCGACTTTCC
AAG
GTCTACTTCACCCTGGTCATTCGTGATTTTGGCGCTGCGGAATGGTTCCACTCACTCCTCCACGCTATCGAAGAACAAGACATCGGAAATCGTATTGAAATTAACATATACCTCACT
GCGAAGTTGAAAGAAGATGAAATGAACAACATCATTGTTCAAGATGTTGGGGCTGAAAAGGATGCCATCACTTCGCTTCGCGCTCCTACTCACTTTGGTCGTCCTAAATGGGACCGCGTG
TTTGGTTCAATTACTGAGAAACACCCTGAAACTGATGTTGGCGTG
TTTTATTGTGGCCCTCCTGCTTTGTCCAAGACTCTACACCAAATGTCGAACAAATGGTCCAATCCAAAGGGCACC
CGGTTCTTCTTCGGCAAAG
AGAACTTTTGA

Retrieve as FASTA