Entry information : AbPrxQ_bisporus
Entry ID 7601
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbPrxQ_bisporus
Name AbPrxQ_bisporus
Class Atypical 2-Cysteine peroxiredoxin (type Q)    [Orthogroup: PrxQ001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbPrxQ_bisporus
start..stop
S start..stop
LbiPrxQ02 275 2e-94 22..244 15..224
PplPrxQ02 263 1e-89 10..249 2..230
AthiPrxQ 257 5e-87 23..244 17..244
AmusPrxQ 256 2e-86 2..243 3..246
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 841506..841721 216 N° 2 841228..841435 208 N° 3 841052..841173 122 N° 4 840833..840987 155
N° 5 840736..840784 49  
complement(join(840736..840784,840833..840987,841052..841173,841228..841435,8415 06..841721))


exon

Literature and cross-references AbPrxQ_bisporus
DNA ref. JGI genome:   scaffold_12 (841721..840736)
Cluster/Prediction ref. JGI gene:   195437
Protein sequence: AbPrxQ_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   249
PWM (Da):   %s   25937.17  
PI (pH):   %s   5.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPRKAAAATTGEEGMDAEQAAPRRSTRIAAQPRTEDDKPAPKPRATKKRTAGDAGASEDGGEGGEDKGKAKKAKGDTTPDDNGTEGSGEDSSATAPVLATIDIGGTLPNLTLKNEKDEDIQVADIASEKGAVVFLVPKADTPGCTTQACGFRDIFDEFAAVNYSVYCLSADSPGAQTKWQSKKELPYSLISDPKRILITALGAGEGGKTKRSHFIFEKGGKLLEKKIPVKPGSPNLALEFIKSTTASS

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGCAAGGCAGCAGCAGCTACAACAGGAGAAGAGGGGATGGATGCAGAGCAAGCGGCTCCCAGGCGTTCAACGCGTATCGCTGCGCAACCCAGGACCGAAGACGACAAGCCCGCT
CCTAAGCCGCGCGCGACGAAAAAGAGAACTGCAGGAGATGCTGGTGCCTCTGAAGATGGCGGCGAAGGTGGCGAAGACAAGGGGAAGGCCAAGAAG
GTCCGTTTCCTGTTCCCGAAATCG
ACACATCGCGACTTGAGCCACTGATCTGGTATCTTCTTTTTCATAGGCCAAGGGGGATACCACTCCTGATGACAATGGCACAGAAGGATCTGGCGAAGACAGTAGTGCCACTGCTCCTGT
CCTAGCGACGATCGACATCGGAGGCACTTTGCCCAATCTCACCTTGAAAAACGAGAAGGATGAGGATATTCAAGTCGCAGATATTGCCAGCGAAAAGGGTGCAGTCGTATTCCTCGTGCC
TAAAGCTGATACGC
GTGAGTTTTTTTCGGTTTGCAAAACGGTAACTGATTCCCCTTTCTTGCCTATAGCCGGTTGCACAACTCAGGCCTGTGGATTCCGTGACATCTTCGACGAATTTGC
TGCGGTCAATTACTCAGTCTATTGTCTCAGCGCAGATTCTCCTGGCGCTCAAACTAAATGGCAGTCAAAG
GTACGTCCACCGCCTGTTTCGCTCTATCGAACCAGAAGAGTCATGTTGTA
CCCCGATTATCCAGAAAGAGCTCCCATATTCGCTTATTTCCGATCCTAAGCGAATACTCATTACCGCTCTTGGCGCTGGTGAGGGTGGAAAAACGAAGAGAAGCCACTTTATCTTTGAGA
AGGGAGGTAAGCTGTTGGAGAAGAAGATACCCGTAAAGCCTGGTGATAG
GTATGATCCACCATCATTGAAATTAACCCCGCTAACACGACTCTTCAGTCCCAATCTCGCCTTGGAATTCA
TTAAGAGTACTACAGCTTCGTCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGCAAGGCAGCAGCAGCTACAACAGGAGAAGAGGGGATGGATGCAGAGCAAGCGGCTCCCAGGCGTTCAACGCGTATCGCTGCGCAACCCAGGACCGAAGACGACAAGCCCGCT
CCTAAGCCGCGCGCGACGAAAAAGAGAACTGCAGGAGATGCTGGTGCCTCTGAAGATGGCGGCGAAGGTGGCGAAGACAAGGGGAAGGCCAAGAAG
GCCAAGGGGGATACCACTCCTGAT
GACAATGGCACAGAAGGATCTGGCGAAGACAGTAGTGCCACTGCTCCTGTCCTAGCGACGATCGACATCGGAGGCACTTTGCCCAATCTCACCTTGAAAAACGAGAAGGATGAGGATATT
CAAGTCGCAGATATTGCCAGCGAAAAGGGTGCAGTCGTATTCCTCGTGCCTAAAGCTGATACGC
CCGGTTGCACAACTCAGGCCTGTGGATTCCGTGACATCTTCGACGAATTTGCTGCG
GTCAATTACTCAGTCTATTGTCTCAGCGCAGATTCTCCTGGCGCTCAAACTAAATGGCAGTCAAAG
AAAGAGCTCCCATATTCGCTTATTTCCGATCCTAAGCGAATACTCATTACCGCT
CTTGGCGCTGGTGAGGGTGGAAAAACGAAGAGAAGCCACTTTATCTTTGAGAAGGGAGGTAAGCTGTTGGAGAAGAAGATACCCGTAAAGCCTGGTGATAG
TCCCAATCTCGCCTTGGAA
TTCATTAAGAGTACTACAGCTTCGTCATGA

Retrieve as FASTA