Entry information : CcinFRe04
Entry ID 7604
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-02 (Christophe Dunand)
Peroxidase information: CcinFRe04
Name CcinFRe04
Class Ferric Reductase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinFRe04
start..stop
S start..stop
CcinFRe03 758 0 13..711 15..674
CcinFRe01 654 0 190..711 4..522
CcinFRe02 596 0 190..711 38..537
PcFRe01 157 2e-40 210..711 242..753
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2215507..2216072 566 N° 2 2216189..2217758 1570  
join(2215507..2216072,2216189..2217758)


exon

Literature and cross-references CcinFRe04
DNA ref. JGI genome:   Chr_4 (2215507..2217758)
Protein sequence: CcinFRe04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   711 (679)
PWM (Da):   %s   78980.5 (75622.7) Transmb domain:   %s   o10-29i232-254o279-301i322-344o354-376i383-405o415-432i589-611o (i200-222o247-269i290-312o322-344i351-373o383-400i557-579o)
PI (pH):   %s   7.16 (7.02) Peptide Signal:   %s   cut: 33 range:33-711
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVALSSSPSLGQLPRVSLLFLTLAHFFTATTAQDGKGMIGGGRTLFKPVCAHTCRSFISKSPILCDSKIPDEPPTTDDTNPFLCYSKDAAFLRTLALCLEDHCQREKLPVSSIEKYWERKTAFGIPPIMTYEGALRHAHEDLQEFDEADVPYLVEGAPLNTTHRVPEEEWMLLYNYMRFFDNSYTHASGFLPGRPLWYSRLEAILEKPLFGHRHRTPMAGDIGIMPTRGQSLYIAYLLITQIFLAIFPLTIYRPAYNSFGPPFSAKLGEFMNAHPELQIIGDRTGVIAMADFVALFLFSSRNNILLWITGWSHGTFLLLHRWLGYCTIIQTCLHSLLLAILYGPDHSYQSQRPFWIWGIVGTLAFVVIWPVSVLQIRKRYYEFFLIFHQVFTALGLIATFFHIYAFFKYTWGYEIWVYIAGIIWFLDRFIRLMRMAVNGYRTAVVTAVDSSGEYFCIEIDGVVVDGHAYLSFPTLAWRFWESHPFSVLSSVAVAGDTPARSKDKAVPGDTKASGSQADPEKTSQSSSASSSLSSRTGRVCPRATILFRSRDGITKTIADRVQALAQGQSLSLPVLVESSYRANPSIRNLSGCTTLLCIAGGVGVTAVLPIIKTFGGGRTRFVWGLRNESLLHALQPDLTSLGPGVHVETSVGARLNVREILEEELERDDEGELGIVVCGPAGMADDARNAISELGSKAKRGVVFVDEAFSW

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGCTCTCAGCTCCAGCCCCTCGCTGGGCCAACTACCCCGCGTCTCCCTTCTCTTCCTCACGCTCGCTCATTTCTTCACTGCTACCACAGCCCAGGATGGGAAAGGGATGATAGGT
GGAGGAAGGACCCTGTTTAAACCTGTCTGTGCTCACACTTGCCGTTCATTTATCTCCAAAAGCCCGATCTTATGCGACTCGAAAATCCCCGACGAACCTCCCACCACCGATGACACGAAT
CCCTTCCTATGCTATAGCAAGGATGCAGCCTTCCTACGAACGCTCGCCCTTTGCCTCGAGGACCACTGCCAGCGGGAGAAGCTGCCTGTCTCAAGCATCGAAAAGTATTGGGAAAGGAAA
ACGGCATTTGGCATCCCGCCCATCATGACCTACGAAGGAGCTCTGCGGCATGCTCACGAAGATCTTCAAGAATTTGACGAAGCCGATGTCCCCTACCTCGTAGAAGGTGCTCCACTGAAT
ACAACTCATCGTGTTCCTGAAGAAGAGTGGATGCTGCTTTACAACTATATGCGATTTTTCGACAACTCCTACACTCACGCCAGCGG
GTACTAACTTCGCGAGTACATTCAACTCCAGTTT
TAAACCGTCGTATACTCATTCTTCTACAGGATCGCGGTAGCCGTCAGCAGTGTCTTTATACCTTTCTATTTTCTTTGTTTAGGTTCCTGCCTGGGCGCCCGCTCTGGTACAGCCGTTTGG
AGGCGATCCTGGAAAAACCATTGTTCGGACATCGTCATCGTACCCCCATGGCTGGCGACATCGGCATCATGCCGACGCGGGGTCAATCCCTATACATCGCCTATCTCCTCATAACCCAGA
TTTTCCTCGCCATATTCCCATTAACGATTTACCGGCCAGCCTACAACTCATTTGGACCACCTTTCTCCGCCAAGCTTGGAGAGTTCATGAACGCGCACCCAGAGCTACAGATTATTGGCG
ACCGTACAGGAGTCATCGCGATGGCAGACTTTGTCGCTCTCTTCCTTTTCTCCAGCAGGAATAACATCCTCCTCTGGATCACCGGCTGGAGCCACGGCACTTTCCTTCTTCTCCATCGTT
GGCTCGGCTATTGCACCATCATCCAAACCTGCCTCCACTCCCTCCTCCTTGCCATCCTTTACGGACCCGACCACAGCTACCAGTCGCAACGGCCCTTTTGGATTTGGGGAATTGTCGGTA
CGCTTGCCTTTGTGGTGATATGGCCAGTCTCCGTTCTCCAAATTCGCAAACGTTACTACGAATTCTTCCTCATCTTCCACCAAGTATTCACCGCCCTCGGTCTGATCGCCACCTTCTTCC
ACATATACGCGTTCTTCAAGTACACATGGGGCTACGAGATCTGGGTGTACATCGCTGGAATTATCTGGTTCCTTGACCGCTTCATCCGCCTCATGAGGATGGCGGTTAATGGGTACCGAA
CGGCTGTCGTCACTGCTGTCGATTCCAGTGGGGAGTATTTCTGCATCGAGATTGACGGTGTCGTTGTGGATGGCCATGCATATTTGTCCTTCCCGACCCTCGCGTGGCGCTTCTGGGAGA
GCCATCCTTTCTCAGTGTTGTCCAGTGTCGCTGTGGCAGGTGATACGCCCGCCAGGTCCAAAGACAAGGCAGTCCCCGGCGACACGAAAGCCTCCGGATCGCAAGCCGACCCCGAGAAAA
CAAGTCAGTCAAGCTCCGCATCTTCAAGCTTGTCGTCGAGAACAGGACGCGTCTGTCCGCGTGCCACGATCCTTTTCCGGTCAAGGGACGGTATCACGAAGACCATCGCCGACCGAGTGC
AGGCACTGGCACAAGGACAAAGCCTCTCCCTCCCCGTCCTGGTCGAATCCTCGTATCGCGCCAACCCATCGATCCGCAACCTTTCAGGATGCACCACACTCCTCTGTATCGCGGGCGGTG
TTGGCGTCACTGCTGTTTTACCGATCATCAAGACGTTTGGTGGAGGTCGTACGCGGTTTGTATGGGGACTACGCAACGAGTCGCTCCTTCATGCGCTTCAACCTGACCTTACTTCGCTTG
GCCCTGGTGTGCATGTCGAGACGAGCGTGGGTGCGCGGTTGAACGTCAGGGAGATTCTGGAGGAGGAGTTGGAGAGGGATGATGAGGGTGAGTTGGGCATTGTAGTTTGTGGGCCGGCTG
GGATGGCGGATGATGCTAGGAATGCGATTAGCGAACTCGGATCCAAGGCGAAAAGGGGCGTGGTGTTTGTGGATGAAGCTTTCAGCTGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGCTCTCAGCTCCAGCCCCTCGCTGGGCCAACTACCCCGCGTCTCCCTTCTCTTCCTCACGCTCGCTCATTTCTTCACTGCTACCACAGCCCAGGATGGGAAAGGGATGATAGGT
GGAGGAAGGACCCTGTTTAAACCTGTCTGTGCTCACACTTGCCGTTCATTTATCTCCAAAAGCCCGATCTTATGCGACTCGAAAATCCCCGACGAACCTCCCACCACCGATGACACGAAT
CCCTTCCTATGCTATAGCAAGGATGCAGCCTTCCTACGAACGCTCGCCCTTTGCCTCGAGGACCACTGCCAGCGGGAGAAGCTGCCTGTCTCAAGCATCGAAAAGTATTGGGAAAGGAAA
ACGGCATTTGGCATCCCGCCCATCATGACCTACGAAGGAGCTCTGCGGCATGCTCACGAAGATCTTCAAGAATTTGACGAAGCCGATGTCCCCTACCTCGTAGAAGGTGCTCCACTGAAT
ACAACTCATCGTGTTCCTGAAGAAGAGTGGATGCTGCTTTACAACTATATGCGATTTTTCGACAACTCCTACACTCACGCCAGCGG
GTTCCTGCCTGGGCGCCCGCTCTGGTACAGCCGT
TTGGAGGCGATCCTGGAAAAACCATTGTTCGGACATCGTCATCGTACCCCCATGGCTGGCGACATCGGCATCATGCCGACGCGGGGTCAATCCCTATACATCGCCTATCTCCTCATAACC
CAGATTTTCCTCGCCATATTCCCATTAACGATTTACCGGCCAGCCTACAACTCATTTGGACCACCTTTCTCCGCCAAGCTTGGAGAGTTCATGAACGCGCACCCAGAGCTACAGATTATT
GGCGACCGTACAGGAGTCATCGCGATGGCAGACTTTGTCGCTCTCTTCCTTTTCTCCAGCAGGAATAACATCCTCCTCTGGATCACCGGCTGGAGCCACGGCACTTTCCTTCTTCTCCAT
CGTTGGCTCGGCTATTGCACCATCATCCAAACCTGCCTCCACTCCCTCCTCCTTGCCATCCTTTACGGACCCGACCACAGCTACCAGTCGCAACGGCCCTTTTGGATTTGGGGAATTGTC
GGTACGCTTGCCTTTGTGGTGATATGGCCAGTCTCCGTTCTCCAAATTCGCAAACGTTACTACGAATTCTTCCTCATCTTCCACCAAGTATTCACCGCCCTCGGTCTGATCGCCACCTTC
TTCCACATATACGCGTTCTTCAAGTACACATGGGGCTACGAGATCTGGGTGTACATCGCTGGAATTATCTGGTTCCTTGACCGCTTCATCCGCCTCATGAGGATGGCGGTTAATGGGTAC
CGAACGGCTGTCGTCACTGCTGTCGATTCCAGTGGGGAGTATTTCTGCATCGAGATTGACGGTGTCGTTGTGGATGGCCATGCATATTTGTCCTTCCCGACCCTCGCGTGGCGCTTCTGG
GAGAGCCATCCTTTCTCAGTGTTGTCCAGTGTCGCTGTGGCAGGTGATACGCCCGCCAGGTCCAAAGACAAGGCAGTCCCCGGCGACACGAAAGCCTCCGGATCGCAAGCCGACCCCGAG
AAAACAAGTCAGTCAAGCTCCGCATCTTCAAGCTTGTCGTCGAGAACAGGACGCGTCTGTCCGCGTGCCACGATCCTTTTCCGGTCAAGGGACGGTATCACGAAGACCATCGCCGACCGA
GTGCAGGCACTGGCACAAGGACAAAGCCTCTCCCTCCCCGTCCTGGTCGAATCCTCGTATCGCGCCAACCCATCGATCCGCAACCTTTCAGGATGCACCACACTCCTCTGTATCGCGGGC
GGTGTTGGCGTCACTGCTGTTTTACCGATCATCAAGACGTTTGGTGGAGGTCGTACGCGGTTTGTATGGGGACTACGCAACGAGTCGCTCCTTCATGCGCTTCAACCTGACCTTACTTCG
CTTGGCCCTGGTGTGCATGTCGAGACGAGCGTGGGTGCGCGGTTGAACGTCAGGGAGATTCTGGAGGAGGAGTTGGAGAGGGATGATGAGGGTGAGTTGGGCATTGTAGTTTGTGGGCCG
GCTGGGATGGCGGATGATGCTAGGAATGCGATTAGCGAACTCGGATCCAAGGCGAAAAGGGGCGTGGTGTTTGTGGATGAAGCTTTCAGCTGGTAA

Retrieve as FASTA