Entry information : AbAPx-CcP01_bisporus (AbHyBpox1)
Entry ID 7607
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2016-12-14 (Bruno Savelli)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2017-12-14 (Marcel Zamocky)
Peroxidase information: AbAPx-CcP01_bisporus (AbHyBpox1)
Name (synonym) AbAPx-CcP01_bisporus (AbHyBpox1)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbAPx-CcP01_bisporus
start..stop
S start..stop
LbiAPx-CcP 699 0 21..591 20..594
AthiAPx-CcP01 679 0 4..557 1..557
LameAPx-CcP01 677 0 1..597 1..593
HsubAPx-CcP02 672 0 21..563 18..560
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 583610..583825 216 N° 2 583877..583963 87 N° 3 584017..584083 67 N° 4 584133..584454 322
N° 5 584506..584619 114 N° 6 584668..584842 175 N° 7 584895..585326 432 N° 8 585378..585758 381
join(583610..583825,583877..583963,584017..584083,584133..584454,584506..584619, 584668..584842,584895..585326,585378..585758)


exon

Literature and cross-references AbAPx-CcP01_bisporus (AbHyBpox1)
Literature Zamocky M. et al. (2014) Cell. Mol. Life Sci. 71:4681-4696
DNA ref. JGI genome:   scaffold_2 (583610..585758)
Cluster/Prediction ref. JGI gene:   190292
Protein sequence: AbAPx-CcP01_bisporus (AbHyBpox1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   597 (576)
PWM (Da):   %s   65145.82 (62919.5) Transmb domain:   %s   o574-596i (o574-596i)
PI (pH):   %s   4.58 (4.46) Peptide Signal:   %s   cut: 22 range:22-597
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLVKKLAPSALLLQAQLSLAAYHWPSPQYDALETFMYEGQRGDGSNLASLVHPCRKRSGTNASVPAQWLRLAFHDIATYNNDNGTGGLDGSIVYELGREENLSIGFNQSLTDFEAFPNKYVSRADLIALGAIFSVATCQGPTIPFRGGRIDAWTAGDFGTPLPQDDITTLTDSFKRMGFSPSDMVGLIACGHSIGGVTSADEPDIVPPGNDPSKPTIVDFDSTGNFDNKVVTEYLDGSTQNPLVVTSNQTLASDLKIFISDANQTIRSFADPNQYNSQCQTLLERMINTVAHGVSLTDEITMIPAKVHDVQLTIERNQLVFKSSLRLPQPMGQKLNTQRTVTMFWCDRYGDSADCQGNTKSAQSVKTTQDDPNNSPITFNMGLFFVHYHFVVPIDSKVSISKFWFEVDEHNGTSAAVYNNGGDDYVVQQDQVILVPTLSSSVMRSNGSYTQTYTNRVGEFFTKVYNITVAVREGSNPSRVYATAYDSAVANFTYAVNTTFDFTRNSSMSPVGGYEFYSGSVEDSGHQMTLDTFADVDGTTYTDDFRQTTFLDNSPYNAPSDVATKTSTSSSPVSFVISAPSLIFGLLLILLPLHLL

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 7 introns) no EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTAGTCAAGAAACTCGCTCCGTCTGCCTTGCTGCTCCAAGCGCAGCTGTCTCTCGCAGCCTACCACTGGCCATCTCCACAGTACGATGCCCTGGAGACTTTCATGTACGAGGGG
CAGCGGGGTGACGGGTCCAATCTTGCCTCGCTTGTTCATCCTTGCCGCAAGCGCTCGGGAACCAATGCCTCCGTGCCTGCCCAATGGCTTCGCCTC
GTGGGTTTCGATACACTTTCTCGT
CATGCTTCGACTTATAACTGAGGATAGGCTTTTCACGACATTGCCACTTACAATAATGACAACGGAACGGGTGGCTTGGATGGGTCCATAGTGTACGAACTTGGGAGGGAGGAGGTTTGT
GGTCACACCTTGTGCTTACCATAAGAATTGCTAAATCCTTGCATCAGAACCTTAGCATTGGATTCAATCAGAGTCTTACTGACTTTGAAGCATTCCCCAACAAATATGTCTCTCGTCAGT
ATTCGACTCACCAGGAATTCGGCTTTCCTGACTATATCAATAGGTGCTGACCTGATTGCCCTGGGTGCTATTTTCTCCGTTGCAACTTGTCAAGGGCCCACTATCCCATTCCGAGGCGGC
CGGATTGACGCGTGGACGGCAGGAGATTTTGGGACTCCCTTACCCCAGGATGACATAACCACTCTGACGGACAGCTTCAAGAGAATGGGATTTTCGCCTTCAGACATGGTTGGTCTGATT
GCATGTGGCCACAGTATCGGTGGTGTCACCAGCGCCGATGAACCTGATATTGTGCCCCCGGGGAACGATCCGTCCAAACCAACCATTGTCGACTTTGATTCGACTGGTAATTTTGATAAT
AAAGT
GTATGTCAGCGCTCTGGATCCGCGTTTTTATTTGCTGACCAGGAGCTACAGTGTCACAGAATATCTTGATGGATCGACTCAAAATCCCCTCGTTGTAACGTCAAACCAAACTCTG
GCTTCCGATCTCAAAATTTTTATCAGTGATGCCAACCAGACTATCCGCAG
GTGAGCAAGTTGACAGGTTTGTTTGTACTTGCCTAAATCCTCTGCCAGTTTCGCCGATCCGAATCAATAT
AATAGTCAATGTCAGACCTTGTTGGAACGAATGATCAACACTGTTGCACATGGCGTTTCGCTAACAGATGAAATCACAATGATTCCGGCAAAAGTGCATGACGTGCAACTGACAATAGAA
CGCAATCAGCTAGTTTTCAAGTCCAGTCTTCGA
GTACGTCGGTTCTTGATCCTGGTCAGATTTCCACGCTGATGCAAAAGTCAAGCTTCCTCAACCCATGGGCCAGAAACTCAACACTCA
AAGGACAGTGACAATGTTTTGGTGTGACAGGTACGGAGATTCGGCCGATTGCCAAGGAAATACAAAGTCGGCACAGTCTGTTAAGACTACTCAAGATGATCCTAACAACTCGCCGATAAC
ATTCAACATGGGGCTCTTCTTTGTACACTACCACTTCGTCGTACCCATAGACTCGAAAGTGTCGATTTCGAAGTTCTGGTTCGAAGTGGACGAGCACAACGGTACCAGCGCAGCTGTTTA
TAACAACGGTGGCGATGACTACGTCGTGCAGCAAGATCAGGTTATATTAGTGCCGACGCTCAGCTCATCAGTGATGCGGTCGAATGGATCATATACACAGACGTACACCAATCGGGTCGG
AGAATTTTTCACCAAGGTCTACAACATCACGGTTGCT
GTGAGTTAGTCTCTTCACGTTTGCACGACATTATCAACTCAGTATTATCAGGTTCGTGAGGGTAGCAATCCTTCTCGGGTTTA
CGCTACCGCATACGATAGTGCCGTTGCCAATTTCACGTATGCCGTAAACACCACTTTTGATTTTACCAGGAATTCTTCCATGTCTCCTGTTGGAGGATATGAGTTCTACTCTGGATCGGT
TGAAGATAGTGGACACCAGATGACGTTGGATACTTTTGCCGATGTGGACGGCACGACTTACACAGATGACTTCAGACAGACGACGTTCCTGGACAATTCTCCCTACAATGCTCCTTCGGA
CGTGGCCACGAAAACATCAACGTCGTCGTCTCCCGTTTCATTTGTGATATCGGCGCCCAGTCTAATTTTCGGCCTACTGTTAATACTCTTACCGCTTCATTTGCTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTAGTCAAGAAACTCGCTCCGTCTGCCTTGCTGCTCCAAGCGCAGCTGTCTCTCGCAGCCTACCACTGGCCATCTCCACAGTACGATGCCCTGGAGACTTTCATGTACGAGGGG
CAGCGGGGTGACGGGTCCAATCTTGCCTCGCTTGTTCATCCTTGCCGCAAGCGCTCGGGAACCAATGCCTCCGTGCCTGCCCAATGGCTTCGCCTC
GCTTTTCACGACATTGCCACTTAC
AATAATGACAACGGAACGGGTGGCTTGGATGGGTCCATAGTGTACGAACTTGGGAGGGAGGAG
AACCTTAGCATTGGATTCAATCAGAGTCTTACTGACTTTGAAGCATTCCCCAACAAA
TATGTCTCTC
GTGCTGACCTGATTGCCCTGGGTGCTATTTTCTCCGTTGCAACTTGTCAAGGGCCCACTATCCCATTCCGAGGCGGCCGGATTGACGCGTGGACGGCAGGAGATTTTGGG
ACTCCCTTACCCCAGGATGACATAACCACTCTGACGGACAGCTTCAAGAGAATGGGATTTTCGCCTTCAGACATGGTTGGTCTGATTGCATGTGGCCACAGTATCGGTGGTGTCACCAGC
GCCGATGAACCTGATATTGTGCCCCCGGGGAACGATCCGTCCAAACCAACCATTGTCGACTTTGATTCGACTGGTAATTTTGATAATAAAGT
TGTCACAGAATATCTTGATGGATCGACT
CAAAATCCCCTCGTTGTAACGTCAAACCAAACTCTGGCTTCCGATCTCAAAATTTTTATCAGTGATGCCAACCAGACTATCCGCAG
TTTCGCCGATCCGAATCAATATAATAGTCAATGT
CAGACCTTGTTGGAACGAATGATCAACACTGTTGCACATGGCGTTTCGCTAACAGATGAAATCACAATGATTCCGGCAAAAGTGCATGACGTGCAACTGACAATAGAACGCAATCAGCTA
GTTTTCAAGTCCAGTCTTCGA
CTTCCTCAACCCATGGGCCAGAAACTCAACACTCAAAGGACAGTGACAATGTTTTGGTGTGACAGGTACGGAGATTCGGCCGATTGCCAAGGAAATACA
AAGTCGGCACAGTCTGTTAAGACTACTCAAGATGATCCTAACAACTCGCCGATAACATTCAACATGGGGCTCTTCTTTGTACACTACCACTTCGTCGTACCCATAGACTCGAAAGTGTCG
ATTTCGAAGTTCTGGTTCGAAGTGGACGAGCACAACGGTACCAGCGCAGCTGTTTATAACAACGGTGGCGATGACTACGTCGTGCAGCAAGATCAGGTTATATTAGTGCCGACGCTCAGC
TCATCAGTGATGCGGTCGAATGGATCATATACACAGACGTACACCAATCGGGTCGGAGAATTTTTCACCAAGGTCTACAACATCACGGTTGCT
GTTCGTGAGGGTAGCAATCCTTCTCGG
GTTTACGCTACCGCATACGATAGTGCCGTTGCCAATTTCACGTATGCCGTAAACACCACTTTTGATTTTACCAGGAATTCTTCCATGTCTCCTGTTGGAGGATATGAGTTCTACTCTGGA
TCGGTTGAAGATAGTGGACACCAGATGACGTTGGATACTTTTGCCGATGTGGACGGCACGACTTACACAGATGACTTCAGACAGACGACGTTCCTGGACAATTCTCCCTACAATGCTCCT
TCGGACGTGGCCACGAAAACATCAACGTCGTCGTCTCCCGTTTCATTTGTGATATCGGCGCCCAGTCTAATTTTCGGCCTACTGTTAATACTCTTACCGCTTCATTTGCTCTGA

Retrieve as FASTA